ID: 966749730

View in Genome Browser
Species Human (GRCh38)
Location 3:183310509-183310531
Sequence AAATTACCGGGTGTGATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5468
Summary {0: 1, 1: 3, 2: 40, 3: 487, 4: 4937}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966749725_966749730 -9 Left 966749725 3:183310495-183310517 CCAACTCAAAAAAAAAATTACCG 0: 1
1: 0
2: 18
3: 246
4: 2444
Right 966749730 3:183310509-183310531 AAATTACCGGGTGTGATGGTGGG 0: 1
1: 3
2: 40
3: 487
4: 4937
966749724_966749730 12 Left 966749724 3:183310474-183310496 CCTGGGCAACAGAGTGAGACTCC 0: 7938
1: 35398
2: 100561
3: 153188
4: 198308
Right 966749730 3:183310509-183310531 AAATTACCGGGTGTGATGGTGGG 0: 1
1: 3
2: 40
3: 487
4: 4937
966749723_966749730 16 Left 966749723 3:183310470-183310492 CCAGCCTGGGCAACAGAGTGAGA 0: 21776
1: 73212
2: 167026
3: 221294
4: 302558
Right 966749730 3:183310509-183310531 AAATTACCGGGTGTGATGGTGGG 0: 1
1: 3
2: 40
3: 487
4: 4937
966749722_966749730 26 Left 966749722 3:183310460-183310482 CCATTGCACTCCAGCCTGGGCAA 0: 36772
1: 108043
2: 179343
3: 213379
4: 164443
Right 966749730 3:183310509-183310531 AAATTACCGGGTGTGATGGTGGG 0: 1
1: 3
2: 40
3: 487
4: 4937

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966749730 Original CRISPR AAATTACCGGGTGTGATGGT GGG Intronic
Too many off-targets to display for this crispr