ID: 966750610

View in Genome Browser
Species Human (GRCh38)
Location 3:183318060-183318082
Sequence CGGGACAAGCTGCAGGTGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 185}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966750610_966750613 -9 Left 966750610 3:183318060-183318082 CCGCTCACCTGCAGCTTGTCCCG 0: 1
1: 0
2: 1
3: 19
4: 185
Right 966750613 3:183318074-183318096 CTTGTCCCGCTGCCTTGTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 99
966750610_966750618 12 Left 966750610 3:183318060-183318082 CCGCTCACCTGCAGCTTGTCCCG 0: 1
1: 0
2: 1
3: 19
4: 185
Right 966750618 3:183318095-183318117 GGACATGAGAAGGTCTTCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 92
966750610_966750620 28 Left 966750610 3:183318060-183318082 CCGCTCACCTGCAGCTTGTCCCG 0: 1
1: 0
2: 1
3: 19
4: 185
Right 966750620 3:183318111-183318133 TCCGTGGATAGCATGCTTCTGGG 0: 1
1: 0
2: 0
3: 4
4: 56
966750610_966750616 2 Left 966750610 3:183318060-183318082 CCGCTCACCTGCAGCTTGTCCCG 0: 1
1: 0
2: 1
3: 19
4: 185
Right 966750616 3:183318085-183318107 GCCTTGTGTGGGACATGAGAAGG 0: 1
1: 0
2: 0
3: 21
4: 177
966750610_966750612 -10 Left 966750610 3:183318060-183318082 CCGCTCACCTGCAGCTTGTCCCG 0: 1
1: 0
2: 1
3: 19
4: 185
Right 966750612 3:183318073-183318095 GCTTGTCCCGCTGCCTTGTGTGG 0: 1
1: 0
2: 0
3: 7
4: 110
966750610_966750619 27 Left 966750610 3:183318060-183318082 CCGCTCACCTGCAGCTTGTCCCG 0: 1
1: 0
2: 1
3: 19
4: 185
Right 966750619 3:183318110-183318132 TTCCGTGGATAGCATGCTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966750610 Original CRISPR CGGGACAAGCTGCAGGTGAG CGG (reversed) Exonic
900294086 1:1939943-1939965 CGGGAGGAGCTGCGGGTGGGTGG + Intronic
901217470 1:7562848-7562870 GTTGACAGGCTGCAGGTGAGTGG - Intronic
901800481 1:11705340-11705362 AGGGAGAAGCTGCAGCTCAGGGG - Intronic
902592240 1:17483309-17483331 CGGGAGGAGGGGCAGGTGAGGGG + Intergenic
902651616 1:17841233-17841255 CCAGAGGAGCTGCAGGTGAGGGG - Intergenic
903212925 1:21828796-21828818 CGGGACAAGCGGGAGGGGAGGGG - Intronic
903779790 1:25813979-25814001 CTGGAGGAACTGCAGGTGAGCGG + Exonic
904774092 1:32896090-32896112 CAGGCTAAGCAGCAGGTGAGGGG - Intronic
904901693 1:33862682-33862704 GGGGACAAGCTGTAGTTGTGTGG - Intronic
905482736 1:38272529-38272551 TGAGGCAAGCTGCAGGTGCGAGG + Intergenic
905620486 1:39441311-39441333 CAGGACACTCTTCAGGTGAGAGG + Exonic
905927818 1:41764406-41764428 TGGGACAAGGTGCGGGTGGGGGG + Intronic
906237869 1:44222721-44222743 TGGGAGAAGAGGCAGGTGAGGGG - Intronic
908457251 1:64315783-64315805 CAGGACAAGCTGAAGTTGAGGGG + Intergenic
908706725 1:66964958-66964980 CAGGGCAAGCAGCAGGTCAGAGG + Intronic
915622240 1:157092838-157092860 TGGGACAGGGTGCGGGTGAGAGG - Exonic
916191276 1:162180586-162180608 CGGGACCTTCTGCATGTGAGAGG + Intronic
917451009 1:175147218-175147240 CGGGCAAAAATGCAGGTGAGAGG - Exonic
919467322 1:197938067-197938089 AGGGAGAAGCAGCAGGTGCGTGG - Intergenic
921157658 1:212450765-212450787 CGGGGCAACCTGCAGCTGATAGG + Intergenic
921488198 1:215740979-215741001 CGGGCCACACAGCAGGTGAGTGG - Intronic
923102350 1:230826572-230826594 CGGGGGAAGCTGGAGGTGAGGGG - Intergenic
924623870 1:245684813-245684835 CTGGACATGCAGCAGGGGAGGGG - Intronic
1062821144 10:535293-535315 GGAGACAAGCAGCAGGCGAGAGG + Intronic
1064123993 10:12643410-12643432 GGAGACGAGCGGCAGGTGAGTGG + Intronic
1069770948 10:70899567-70899589 CTGGACAGGCTGCAGATGACAGG + Intergenic
1073363546 10:102918778-102918800 CGGGTCAAGCTGCGGGTGTACGG + Exonic
1074875588 10:117610689-117610711 CGGGTCAAGCAGCAAGTCAGTGG + Intergenic
1076526725 10:131116800-131116822 CGAGACATGCTGCTGGAGAGAGG - Exonic
1076920993 10:133454593-133454615 CAGGAGAGGCTGGAGGTGAGAGG + Intergenic
1076994098 11:289925-289947 CACGACACGCTGCACGTGAGCGG + Exonic
1077008128 11:368852-368874 TGGGACAAGGTCCCGGTGAGAGG + Intergenic
1077205161 11:1338482-1338504 CGGGACCAGGTGGAGGTGACTGG + Intergenic
1077214756 11:1390654-1390676 CGGGCCCCGCTGCAGGTGCGCGG + Intronic
1077339690 11:2020790-2020812 CAGGACAGGCGGCAGGTGGGAGG - Intergenic
1077530533 11:3092759-3092781 GGGGACAGGCTGAAGGTGAGAGG + Intronic
1078319187 11:10318549-10318571 GAAGACAAGCTGCAGGTGATGGG + Intronic
1080615082 11:33938706-33938728 CAGGAGAAGGTTCAGGTGAGGGG - Intergenic
1081493173 11:43582332-43582354 GGGGCAAAGCTGCAGGAGAGGGG + Intronic
1081701328 11:45154714-45154736 CGGGAGAAGGTGCAGTTGGGAGG - Intronic
1081873280 11:46392603-46392625 CGGGACAAGATCCCGGAGAGCGG + Intergenic
1083995096 11:66267727-66267749 CGCGAGAAGCTGCAGGCGTGGGG - Exonic
1086490850 11:87356539-87356561 CGGGGCAGGCTGAAGTTGAGGGG + Intergenic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1088908780 11:114174862-114174884 CAGGTCAAGCTGCAGGGAAGAGG + Intronic
1089067005 11:115669823-115669845 TAGGAGAAGCTGCAGGTGAGTGG + Intergenic
1089116990 11:116103381-116103403 CGGGACAAGCTGCTGCTCTGGGG - Intergenic
1089284063 11:117394479-117394501 CGGCACAGGGAGCAGGTGAGGGG + Exonic
1090650251 11:128799989-128800011 GGGAAGAAACTGCAGGTGAGCGG - Intronic
1091344235 11:134842263-134842285 CGGGACAATCAGCAGGAGGGAGG + Intergenic
1202822675 11_KI270721v1_random:75979-76001 CAGGACAGGCGGCAGGTGGGAGG - Intergenic
1091490660 12:929811-929833 AGGGTCCAGCTGAAGGTGAGGGG - Exonic
1094294968 12:28895375-28895397 CGTGGCAAGCTGAAGGTGAAAGG + Intergenic
1094848486 12:34371931-34371953 GGGGACAAGCTGAAGGTGGCAGG - Intergenic
1096649393 12:53054427-53054449 CGGGACAAGTACCTGGTGAGGGG + Exonic
1098971712 12:76863973-76863995 CTGGAGAAGCTGCTGGGGAGAGG - Intronic
1099728010 12:86459672-86459694 CGGGTAAAGCTGTGGGTGAGTGG - Intronic
1100611702 12:96195579-96195601 AGGGACAAGCTGCAGTTAGGCGG + Intronic
1101818161 12:108161923-108161945 CGGTAAAATCTGCATGTGAGGGG - Intronic
1103933391 12:124462501-124462523 CAGGAAAAGCGGCAGGTCAGAGG + Intronic
1103948055 12:124538010-124538032 CGGGACGTGCTGCAGGTGGCTGG - Intronic
1104992735 12:132635241-132635263 CGGGCCAGGCTGTGGGTGAGTGG - Intronic
1105612288 13:21978872-21978894 CTGGAGAAAGTGCAGGTGAGTGG - Intergenic
1106440558 13:29763340-29763362 CGGGACAAGCCGCAGCAGAGTGG - Intergenic
1108269860 13:48748953-48748975 CAGAACAAGCAGCAGGTGTGAGG - Intergenic
1110619289 13:77577489-77577511 CGGGACCAGGTGGAGGTGATTGG - Intronic
1112234227 13:97621260-97621282 CGGGACCAGGTGGAGGTGATTGG - Intergenic
1116862702 14:50007387-50007409 CTGGACAGCCTGCAGTTGAGGGG - Exonic
1121109957 14:91305757-91305779 ACCGCCAAGCTGCAGGTGAGCGG - Exonic
1122688786 14:103522015-103522037 CCCGACAACCTGCAGGTGCGGGG - Exonic
1124964688 15:34424144-34424166 CTGGGCAAGCTGGAGGAGAGGGG - Intronic
1124981304 15:34570370-34570392 CTGGGCAAGCTGGAGGAGAGGGG - Intronic
1125530955 15:40413021-40413043 CTGGACAAGCTGGGGATGAGGGG + Exonic
1125953948 15:43776683-43776705 CTGGAGAAGGTGCAGGGGAGAGG - Intronic
1129357516 15:75001452-75001474 GGAGACAAGATGAAGGTGAGAGG - Intronic
1129661104 15:77553650-77553672 GGGGACAGGCTGCCGGTGGGGGG - Intergenic
1130195770 15:81779084-81779106 TGGCACAAGCAGGAGGTGAGTGG - Intergenic
1131913659 15:97237668-97237690 GGACAGAAGCTGCAGGTGAGAGG - Intergenic
1132302411 15:100784204-100784226 CAGGGCAAGCTGCAGCAGAGGGG + Intergenic
1132861992 16:2076384-2076406 AGGGACAAGCTGCAGGCTAGGGG - Intronic
1133035427 16:3031402-3031424 CGGCAGCAGCTGGAGGTGAGTGG - Intronic
1133691553 16:8220540-8220562 CGGGACCAGGTGGAGGTAAGTGG + Intergenic
1136043685 16:27599672-27599694 GGTGCCAGGCTGCAGGTGAGAGG - Intronic
1137044233 16:35641398-35641420 CTGGCCAAGCTGCAGGGTAGAGG + Intergenic
1137669732 16:50272118-50272140 CAGGACATGCTGGAGGTGACAGG + Intronic
1141775785 16:86121837-86121859 CGGGACAAGCAGGAGGAGGGAGG - Intergenic
1147244034 17:39109000-39109022 CGGGCCAAGCTGCAGGCCAGGGG + Intronic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1151569052 17:74917112-74917134 GGGGACAATCTGCAGTTTAGAGG + Exonic
1152509119 17:80773231-80773253 GGTGACAAACTGCAGGTGAAGGG - Intronic
1153892845 18:9534255-9534277 CCCGAGAAGCAGCAGGTGAGAGG + Intronic
1154051348 18:10962299-10962321 CAGGAAAAGCTGCAGGCAAGCGG - Intronic
1156350060 18:36296094-36296116 CGGGCCACACAGCAGGTGAGCGG + Intergenic
1157328696 18:46687633-46687655 GGGGAGGAGCTGCAGGTGAGCGG - Intronic
1157502766 18:48202781-48202803 GGGGTAAAGCTGCAGGGGAGAGG - Intronic
1158952885 18:62511818-62511840 CAGAACAACCTGCAGTTGAGGGG + Intergenic
1158958076 18:62561369-62561391 CAGGAGAAACTGGAGGTGAGTGG - Intronic
1159754819 18:72351307-72351329 TCAGACAACCTGCAGGTGAGTGG - Intergenic
1160732652 19:648301-648323 CGGGAGAAGGGGCAGGTTAGAGG + Intronic
1162249116 19:9427663-9427685 AGAGGCAAGCTGCAGCTGAGAGG - Intronic
1162706582 19:12559595-12559617 CTGGACAAGCTGGACGTGAAAGG + Intronic
1166774363 19:45303317-45303339 GGCAACAGGCTGCAGGTGAGGGG - Exonic
1168279017 19:55294119-55294141 GGAGACCAGCTGCGGGTGAGTGG + Exonic
1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG + Exonic
1168405410 19:56107912-56107934 CGGGAGGGGCTGCAGGTGTGTGG + Intronic
925187552 2:1859740-1859762 TGGGACGTGGTGCAGGTGAGAGG - Intronic
925450891 2:3968450-3968472 CGGGACCAGGTGGAGGTGATTGG + Intergenic
926390842 2:12390964-12390986 GGGGACTGGCTGCAGGTGAGAGG - Intergenic
926424839 2:12731360-12731382 CAGGTCAAGTTGGAGGTGAGGGG - Intronic
927552763 2:24013373-24013395 CAGGAAAAGCTGCAGGTAAAAGG - Exonic
928123849 2:28602795-28602817 AGGGAAAAGCTGCAGATGAGAGG - Intronic
929266133 2:39920718-39920740 CGGGGCAGGATGCAGGTGGGTGG + Intergenic
931262865 2:60635602-60635624 GGGGAGAGCCTGCAGGTGAGTGG + Intergenic
932313877 2:70767322-70767344 CGGGGCAACCGGCACGTGAGCGG - Intronic
937119821 2:119433340-119433362 TGGGCCAGGCTGCAGCTGAGAGG + Intronic
937189966 2:120085772-120085794 CAGGACAAGCTGGAGGTATGAGG - Intronic
938759606 2:134412097-134412119 GGGGACAAGCTGCAGTTCAGTGG - Intronic
941616494 2:167726367-167726389 CTGGACAAGGGGCAGGTGGGCGG - Intergenic
943365970 2:186967832-186967854 CAGGGCAAGCTGGAGGTGAGAGG - Intergenic
944681778 2:202084020-202084042 GGGGAGAAGGTGCAGGGGAGGGG + Intronic
945706959 2:213247664-213247686 AGGGACAGGGTGCAGGGGAGAGG - Intergenic
946027087 2:216678472-216678494 AGAGAAAAGCTGCAGGGGAGGGG - Intronic
948429922 2:237912620-237912642 GAGGACAAGCTGAAGGTGATGGG - Intergenic
948572739 2:238927650-238927672 TGGGAGCAGCTGCAGGGGAGGGG + Intergenic
1171480293 20:25450168-25450190 CGGGAAAAGGAGCAGGTGAAAGG + Intronic
1172026421 20:31951867-31951889 GCGGACAAGCGGCAGGTGAGAGG - Exonic
1173836234 20:46128088-46128110 AGGGAGAAACTGCAGGTGAGGGG + Intronic
1174167103 20:48592789-48592811 CAGGACAGGCTGCAGGTGAGAGG + Intergenic
1174224842 20:48989402-48989424 CCGGACATGGTCCAGGTGAGTGG - Exonic
1175108869 20:56631676-56631698 ATGGACGAGGTGCAGGTGAGCGG + Exonic
1175998363 20:62821320-62821342 CCGGAGAGGCTGCAGATGAGAGG - Intronic
1176185127 20:63774118-63774140 CGGGACAAGCTGTGGGTGCTGGG - Intronic
1176346981 21:5757575-5757597 CAGCACAAGTTGCATGTGAGTGG - Intergenic
1176353795 21:5878159-5878181 CAGCACAAGTTGCATGTGAGTGG - Intergenic
1176497846 21:7566880-7566902 CAGCACAAGTTGCATGTGAGTGG + Intergenic
1176541302 21:8155645-8155667 CAGCACAAGTTGCATGTGAGTGG - Intergenic
1176560253 21:8338690-8338712 CAGCACAAGTTGCATGTGAGTGG - Intergenic
1176861673 21:14014512-14014534 GGCGACAGGCTGCATGTGAGAGG + Intergenic
1177357804 21:20031551-20031573 CGGGACAACCAGCTGCTGAGAGG - Intergenic
1177426801 21:20934078-20934100 TGGGACCAGCTACAGGTAAGGGG + Intergenic
1181845222 22:25701667-25701689 CGGGACCAGATGCAGGAGTGGGG + Intronic
1183083760 22:35474112-35474134 CTGGACAGGCTGGTGGTGAGAGG + Intergenic
1183493125 22:38127281-38127303 GGGGACAGGGTGCAGGGGAGGGG + Intronic
1184882251 22:47315920-47315942 AGGGCCAGGCTGCAGGTGTGGGG - Intergenic
1203246243 22_KI270733v1_random:72064-72086 CAGCACAAGTTGCATGTGAGTGG - Intergenic
950103348 3:10372053-10372075 TGGGAGAAGGGGCAGGTGAGAGG + Intronic
950106298 3:10391229-10391251 CGAGTCACTCTGCAGGTGAGGGG + Intronic
953616188 3:44492829-44492851 CTGGACATGTTGCAGGTCAGGGG + Intergenic
957150944 3:76485456-76485478 CGGGCCACACAGCAGGTGAGTGG - Intronic
958907926 3:99962144-99962166 CTGGAAAGGCTGAAGGTGAGGGG + Intronic
963604761 3:147404926-147404948 AGGGACAAGTTGCAGCGGAGAGG - Intronic
965166205 3:165196420-165196442 CGGGAGAAGGTGCGGGGGAGGGG + Intronic
966750610 3:183318060-183318082 CGGGACAAGCTGCAGGTGAGCGG - Exonic
968504701 4:966458-966480 CAGGACATCCGGCAGGTGAGTGG - Exonic
968549817 4:1216470-1216492 GTGGACAGGCTGCAGGGGAGTGG - Intronic
973205209 4:47552170-47552192 TGGCCCAAGCTGGAGGTGAGTGG - Intronic
973613502 4:52658758-52658780 GGGGATAAGCTGGAGGTGGGGGG - Intronic
975505583 4:75133275-75133297 CGGGGCCTGTTGCAGGTGAGGGG - Intergenic
979703609 4:123694822-123694844 CGGGACAAGATGGAGGTAATTGG - Intergenic
985314960 4:188647927-188647949 AGGGAAAAGCTGTATGTGAGAGG + Intergenic
985511440 5:316230-316252 CCAGAGAAGCTGCAGGTGTGGGG - Intronic
985992344 5:3573913-3573935 AGGGACAGGCAGCAGGGGAGCGG + Intergenic
993326353 5:86542698-86542720 GGGGACAGGCTTAAGGTGAGAGG - Intergenic
997614246 5:135235755-135235777 GGGAACAGGCTGCAGGTGGGGGG - Intronic
998138446 5:139686935-139686957 GGGCACAGGCTGCAGGTGAGAGG - Intergenic
998158134 5:139797486-139797508 CAGGACAAGCTGCAGCGGGGAGG - Intronic
998639640 5:143995195-143995217 AAGGACATGCTGCTGGTGAGTGG + Intergenic
1001775789 5:174328140-174328162 GGGGACAGGCTGCTGGTGACGGG + Intergenic
1002094149 5:176821235-176821257 AAGGACAAGCCACAGGTGAGAGG - Intronic
1002181247 5:177432174-177432196 CAGGGCAAGCAGCAGGTGTGGGG - Intronic
1006058628 6:31403688-31403710 CGGGAGCTGCTGCTGGTGAGTGG + Exonic
1006185904 6:32181598-32181620 AGGGGCCAACTGCAGGTGAGGGG - Exonic
1007252866 6:40508243-40508265 CAGGACATGCTGCAGGTAAGGGG + Intronic
1016829204 6:148416941-148416963 CTGGGCAAGCAGCAGGTGATGGG + Intronic
1018226421 6:161633821-161633843 GGGGACAAGATGCAGGTGCCAGG + Intronic
1018422388 6:163650595-163650617 CAGGAGAAGCTGCGGATGAGTGG + Intergenic
1018697161 6:166399380-166399402 AGAGACAAGCTGGAGGTGATGGG + Intergenic
1018751454 6:166810196-166810218 CGGGACTAGGTGGAGGTGATTGG - Intronic
1019052600 6:169194720-169194742 CGAGCCCAGCTGCAGGGGAGAGG - Intergenic
1020212440 7:6166685-6166707 AGGAACCAGCTGCAGGTGGGAGG + Intronic
1022332815 7:29396684-29396706 AGGGACATGCAGCAGGAGAGTGG - Intronic
1022500250 7:30878238-30878260 GGAGACAAGCTGCAAGTGAGAGG - Intronic
1032011563 7:128351167-128351189 CGGGCCAAGCCCCAGGGGAGGGG + Exonic
1034080863 7:148276496-148276518 CGGGACAAGCTGGAAGTGCTGGG - Intronic
1035762364 8:2078344-2078366 CGGGCCAAGCCGCAGCTTAGGGG + Intronic
1036599182 8:10243338-10243360 AAGGACAAGCTGTAGGTGAGTGG - Intronic
1037362141 8:18084596-18084618 AGGGACAAGGAGCAGTTGAGTGG + Intronic
1037550089 8:19962299-19962321 CAGGGCAAGCTGCTGGTGATGGG - Intronic
1037807977 8:22069070-22069092 CAGGGCAAGTTGCAGGTGTGGGG - Intronic
1039660011 8:39450881-39450903 CAGGACATGCGGCAGGGGAGTGG - Intergenic
1045305318 8:100952400-100952422 CGGCAGAGGCTGCAGGGGAGAGG - Intronic
1049745808 8:144262816-144262838 CGGTGCACCCTGCAGGTGAGGGG - Intronic
1049745819 8:144262845-144262867 CGGTGCACCCTGCAGGTGAGGGG - Exonic
1049953905 9:673759-673781 AGGGACAAGCTGCATGTGCTAGG - Intronic
1056338394 9:85600794-85600816 CGGGGCAGGATGCAGTTGAGTGG - Intronic
1057209322 9:93191128-93191150 CAAGACAAGCTCCAGGTCAGCGG + Intronic
1058487603 9:105458034-105458056 CTGGCCAAGCTGCAGGTGGCAGG - Intronic
1058572160 9:106358625-106358647 GGGGAGAAGCTACAAGTGAGTGG + Intergenic
1060363000 9:122978593-122978615 CTGACCAAGCTGCAGGAGAGTGG - Intronic
1060968404 9:127724322-127724344 CGGGACGAGCAGCAGGAGAAAGG + Exonic
1062582589 9:137235083-137235105 GGGGACCTGCTGGAGGTGAGTGG - Intronic
1062722654 9:138052487-138052509 AGGGAGATGCTGGAGGTGAGGGG + Intronic
1203462576 Un_GL000220v1:55136-55158 CAGCACAAGTTGCATGTGAGTGG - Intergenic
1185741676 X:2538428-2538450 CTAGACAAGATGCAGGTGCGTGG + Intergenic
1194354580 X:92866697-92866719 CGGGACAAGGTGGAGGTAATTGG + Intergenic
1200016563 X:153168953-153168975 CAGGACAAGCTGAAGGTAATTGG + Intergenic