ID: 966750638

View in Genome Browser
Species Human (GRCh38)
Location 3:183318260-183318282
Sequence TCACCAACATGCTGTCTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966750636_966750638 20 Left 966750636 3:183318217-183318239 CCTGGAAGGTCAGACAATTGTAA 0: 1
1: 0
2: 3
3: 17
4: 154
Right 966750638 3:183318260-183318282 TCACCAACATGCTGTCTTGATGG 0: 1
1: 0
2: 0
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966750638 Original CRISPR TCACCAACATGCTGTCTTGA TGG Intronic