ID: 966752102

View in Genome Browser
Species Human (GRCh38)
Location 3:183331914-183331936
Sequence CCATAGATAAAGGTAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966752094_966752102 5 Left 966752094 3:183331886-183331908 CCATTTACTACATGAAAGTACTT 0: 1
1: 0
2: 1
3: 28
4: 218
Right 966752102 3:183331914-183331936 CCATAGATAAAGGTAGAGGGAGG 0: 1
1: 0
2: 1
3: 14
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966752102 Original CRISPR CCATAGATAAAGGTAGAGGG AGG Intronic
900358891 1:2278548-2278570 CCATTGCTAAAGGTAGAGCCCGG + Intronic
901344939 1:8531652-8531674 CCATAGTTAAAGGCAGAGTGTGG - Intronic
901518691 1:9767079-9767101 CCATAGATATTTGTAGAGGGAGG - Intronic
901779403 1:11583438-11583460 CCAGAGACAAAGGGAGAAGGTGG + Intergenic
902418286 1:16256112-16256134 CCATAGGGAAAGGTAGCAGGTGG - Intronic
903467584 1:23562727-23562749 ATATAGATAAAGGAAGAAGGTGG - Intergenic
905712565 1:40118984-40119006 TCTTAGATAAAGGTAGAAGATGG + Intergenic
906100465 1:43257177-43257199 GGATAGACAAAAGTAGAGGGAGG - Intronic
908072049 1:60471601-60471623 CCGGAGATGAAGGTATAGGGAGG - Intergenic
909204613 1:72739540-72739562 CCACAGAGCAAGGTAGAGAGAGG - Intergenic
912139392 1:106703514-106703536 ACATACATCAAGGAAGAGGGAGG - Intergenic
913231800 1:116746072-116746094 CCATTGATAAATTTAGAGGTGGG + Intergenic
915658868 1:157384224-157384246 TCATGGATAAAGGCACAGGGAGG + Intergenic
919813559 1:201423982-201424004 CCATACATGAAGGAAGATGGGGG - Intronic
921816611 1:219571006-219571028 CCAAAGAAAAAGGTAGTGGAGGG + Intergenic
922063908 1:222117603-222117625 CCATGAATAAAGGCAGAGGGAGG + Intergenic
922163369 1:223094823-223094845 CCATAGAGATAGGTGCAGGGAGG - Intergenic
922650088 1:227330411-227330433 CCATTGGTGATGGTAGAGGGAGG + Intergenic
924644279 1:245862964-245862986 CCAGAGAAGGAGGTAGAGGGAGG - Intronic
1062854208 10:771528-771550 CCATAGATAAACCCAGAAGGTGG + Intergenic
1064912823 10:20421595-20421617 CCCTACTTAACGGTAGAGGGTGG - Intergenic
1064965636 10:21012815-21012837 CCATAGCTGACGGTGGAGGGAGG - Intronic
1066495473 10:35937900-35937922 ACATGGAGAAAGGCAGAGGGAGG - Intergenic
1073826516 10:107330234-107330256 CAATAGAGAAAGCTAGAGGGTGG - Intergenic
1074784389 10:116826179-116826201 GCAGAGATGAAGGTGGAGGGAGG - Intergenic
1076228859 10:128803359-128803381 CCAGAGGTAAAGGTAAAGGGAGG - Intergenic
1076660764 10:132054641-132054663 CCATAGATTAAGGGAGGAGGGGG + Intergenic
1079666069 11:23107184-23107206 CCACAGATTATGGTAGAGGCTGG - Intergenic
1081413825 11:42789550-42789572 TCCTAGAAAAAGGTAGAGGAAGG - Intergenic
1083588983 11:63881439-63881461 CAAGAGATAAGGGTAGAGGAAGG - Intronic
1084970738 11:72770723-72770745 CCAGAAATGCAGGTAGAGGGAGG + Intronic
1086348620 11:85922898-85922920 ACAGAGATAAGGGTAGAGAGTGG - Intergenic
1088913965 11:114212932-114212954 CCAGTGATGAAGGTTGAGGGAGG - Intronic
1090611971 11:128479554-128479576 CCATAGAGAAAGGAAGATGTAGG - Intronic
1090668690 11:128931126-128931148 ACATACATAGAGGTTGAGGGAGG - Intergenic
1091829873 12:3542115-3542137 CCCTACATGGAGGTAGAGGGTGG + Intronic
1095777643 12:46026831-46026853 CCAGAGACAAAGGGAGATGGTGG - Intergenic
1096633518 12:52944690-52944712 CCAAGGATAAAGGAAGAGGAAGG - Intronic
1096866819 12:54569388-54569410 GCACAGCTAAAGGCAGAGGGAGG - Intronic
1097086680 12:56473940-56473962 CTGTAAATAGAGGTAGAGGGGGG + Exonic
1097732013 12:63139250-63139272 TCATAGGTAAAGGGTGAGGGGGG - Intergenic
1098543258 12:71683511-71683533 CCAAGGATAAAGGGAGTGGGAGG - Intronic
1100957323 12:99923393-99923415 CCCAAGATAAAGGCAGAGGTGGG + Intronic
1102409843 12:112708235-112708257 CTTTAGATAAAGGTACAGAGAGG - Intronic
1103231839 12:119337934-119337956 CCATAGAGAGATGTAGAGAGTGG + Intronic
1104581299 12:130012880-130012902 CAACAGATACAGGTATAGGGAGG + Intergenic
1106509923 13:30403899-30403921 CCAAAGATAAATGTAGGTGGTGG - Intergenic
1107743102 13:43474930-43474952 CCACAGAGAAAGGGAGAAGGAGG + Intronic
1108328161 13:49355791-49355813 ACATATATAAAGGCAGGGGGAGG + Intronic
1108792660 13:53990740-53990762 ACTTAGATAAAGGTATAGGCAGG - Intergenic
1109121584 13:58464473-58464495 CTATAAATAAAGGGAGAAGGAGG - Intergenic
1110541189 13:76708692-76708714 CCAGAGGCAAAGGTAGAAGGAGG - Intergenic
1110667178 13:78131253-78131275 CCATTGATACAGCTAGAGGTGGG - Intergenic
1110987534 13:81989939-81989961 CCATAGAAAAAGGAAGACAGTGG - Intergenic
1112221414 13:97494991-97495013 CCATAGACAAAGAAAGATGGAGG - Intergenic
1118073233 14:62269216-62269238 CCATAGATAAGGATAGAGGGTGG - Intergenic
1123799934 15:23809059-23809081 CTGTACATAAAGGTAGAGGCTGG - Intergenic
1124192115 15:27588861-27588883 CCATAGATGAGGGAAGAGTGTGG + Intergenic
1125532923 15:40425340-40425362 CCATTGAGAAAGGTAAGGGGAGG - Intronic
1126195559 15:45926831-45926853 CCATAGAACAGGGTGGAGGGTGG - Intergenic
1126840143 15:52709841-52709863 AAATAGAGCAAGGTAGAGGGCGG + Intergenic
1127719927 15:61689330-61689352 CCAGAGACAAAGGGAGAAGGTGG - Intergenic
1128639172 15:69323317-69323339 CCATAGGTGAAGGTGGAGGCTGG - Intronic
1135132424 16:19863937-19863959 CCATGGATCAAGGTTGCGGGGGG - Intronic
1136282799 16:29223698-29223720 CCATAGAAAAAGGCACAGGCTGG + Intergenic
1137239776 16:46646135-46646157 CCACAGAAAAAGGCAGTGGGGGG + Intergenic
1138430626 16:56966274-56966296 CCCTAAATAAAAGTAGATGGAGG - Intronic
1143590566 17:7884268-7884290 CCATAAAGAAAGGGAGAGGGGGG - Intronic
1145787353 17:27602930-27602952 CCCTAGAAGAAGGTCGAGGGAGG + Intronic
1146009725 17:29184144-29184166 CCATGGATTAAGGTTGAGGGAGG + Intergenic
1149542141 17:57475482-57475504 CCTCAGATAAAGCAAGAGGGAGG - Intronic
1150953301 17:69825997-69826019 CCATGGAAAATGGTAGAGGAAGG + Intergenic
1151922135 17:77164785-77164807 CCATAGATACTGGTACAGTGTGG + Intronic
1153294578 18:3533530-3533552 CCATAGATACAGGTACATTGGGG - Intronic
1154273571 18:12940519-12940541 CCGTAGAGGAAGGTATAGGGAGG - Intergenic
1155362782 18:25018510-25018532 CCACAGACCAAGGTTGAGGGTGG + Intergenic
1156030503 18:32707286-32707308 CCATGGATACAGCTAGAGGAGGG - Intronic
1156453865 18:37281887-37281909 CCACAGGTAAAGTTAGAGAGGGG - Intronic
1157818467 18:50748414-50748436 CCTTAAATAAAGGCAGAGGGAGG + Intergenic
1159540008 18:69762866-69762888 CCAAAGATGAAGGTAGATGCAGG - Intronic
1159805619 18:72955103-72955125 CTATAGATGAAGGCAGAGTGTGG + Intergenic
1163330121 19:16631081-16631103 CCAAAGAGAAAGGGAGAGGAAGG + Intronic
1164541658 19:29125988-29126010 ACATAGGAAAAGGAAGAGGGTGG + Intergenic
1167008186 19:46788616-46788638 CCAGGGATAAGGGTAGGGGGCGG + Intergenic
1167211629 19:48137270-48137292 TCCTGGATAAAGGGAGAGGGAGG - Intronic
925258753 2:2511697-2511719 CCATAGCAAAAGGCAGATGGAGG - Intergenic
928496965 2:31842834-31842856 TTATAGACAAAGGTTGAGGGGGG + Intergenic
928572996 2:32627394-32627416 CCAAAGAAACAGTTAGAGGGCGG - Intergenic
928745414 2:34408170-34408192 CCAAAGATACAGGAAGATGGGGG + Intergenic
929820446 2:45269234-45269256 CCAGAGATAAAGCTGGATGGTGG + Intergenic
931382368 2:61765545-61765567 CCACAGATAAAGCCACAGGGTGG - Intergenic
932897125 2:75651043-75651065 CCTAAGAGAAAGGGAGAGGGAGG + Intronic
933470442 2:82716130-82716152 TCATAGGTACAGGTAGAAGGAGG - Intergenic
938807932 2:134824069-134824091 CCATAAATAAAGACAGAAGGGGG + Intergenic
942565068 2:177257888-177257910 CCATAGAAGGAGGTAGAGGATGG - Intronic
943722943 2:191223687-191223709 CCATGGAAAAAGAGAGAGGGAGG + Intergenic
947843033 2:233220869-233220891 CGATAGCTGAAGGAAGAGGGAGG + Intronic
947969848 2:234313749-234313771 CCATAGACAGAGGCAGAGGGTGG - Intergenic
948779294 2:240308149-240308171 CCAGAGAGAAAGGTAAACGGTGG - Intergenic
1170594504 20:17794828-17794850 GCAGAGATAGAGGTAGGGGGAGG - Intergenic
1173343993 20:42181518-42181540 CCATAGAGGAAGGTTGAGGGAGG - Intronic
1173396444 20:42684452-42684474 CCAAAGTGAAAGGTTGAGGGTGG + Intronic
1177309535 21:19371815-19371837 CCATACATAAGTGTGGAGGGTGG + Intergenic
1177993837 21:28071604-28071626 CCACAGATCAGGGTGGAGGGTGG + Intergenic
1178183363 21:30190492-30190514 CCATATGTAATGGTAGAGGCGGG + Intergenic
1178633981 21:34286489-34286511 CCTTAGTTTAATGTAGAGGGAGG + Intergenic
1179241579 21:39597675-39597697 CCATAGAGAATGGAAGAGGCGGG + Exonic
1181340914 22:22179184-22179206 CCAGAGATACAGGAAGTGGGGGG - Intergenic
1183086177 22:35488664-35488686 CCATAGAGAAACGTGGTGGGCGG + Intergenic
1183245074 22:36687078-36687100 CCATGGATCAAGGTGGAGGATGG - Intronic
1184061700 22:42086818-42086840 CCATAAAAAAAGATATAGGGAGG - Intronic
952710017 3:36420654-36420676 CCGTGGATTGAGGTAGAGGGGGG - Intronic
953284028 3:41588465-41588487 CCATAGATAAAAGTTCAGAGTGG - Intronic
955684616 3:61537579-61537601 CCAAAGAAAAAGGAATAGGGAGG - Intergenic
955890398 3:63644482-63644504 GCATAGAGAAAGGCAGAGAGTGG - Intergenic
958905849 3:99941461-99941483 CCATATGTATAGGTAGAAGGTGG + Intronic
960107103 3:113809628-113809650 CTTCAGATAAAGGAAGAGGGAGG - Exonic
960313756 3:116150570-116150592 CCAGAGAAAAAGCTAGAGTGGGG + Intronic
961507580 3:127380770-127380792 CCATCGATAAAGTCAGAGGCTGG - Intergenic
963660908 3:148128270-148128292 GCAAAGATAAAAGCAGAGGGAGG + Intergenic
964123341 3:153209545-153209567 CCATAAATGTAGGTAGAGGCAGG + Intergenic
964192962 3:154026931-154026953 ATAGAGATAAAGGTAGAGGGGGG + Intergenic
966714715 3:183003813-183003835 CAAGAGAAACAGGTAGAGGGAGG - Intergenic
966752102 3:183331914-183331936 CCATAGATAAAGGTAGAGGGAGG + Intronic
967174329 3:186849159-186849181 CCAGAGATAAAGGGTGACGGGGG - Intronic
970253623 4:14143499-14143521 CCATAGATAATGATAGAGGAGGG + Intergenic
970630306 4:17935592-17935614 CAAGAGAGAAAGGAAGAGGGAGG - Intronic
976416197 4:84778583-84778605 CCAAAGAAAAAGTTAGATGGAGG + Exonic
976486036 4:85606206-85606228 CCATAGATAAAGGAAAAGATAGG + Intronic
977696235 4:99969711-99969733 CCAGAGATGAATGAAGAGGGGGG - Intergenic
981332436 4:143527519-143527541 ACATAAAGAAAGGAAGAGGGTGG - Intronic
981681985 4:147409816-147409838 CACAAGATAAAGGAAGAGGGCGG - Intergenic
983171114 4:164537628-164537650 CCACAGAAAAAGTTAGAGGTGGG + Intergenic
983969197 4:173850399-173850421 CCATACATAAAATGAGAGGGTGG - Intergenic
988375856 5:30434899-30434921 GCAGAGATAAAAGTAGAAGGAGG - Intergenic
988513125 5:31882448-31882470 CCATAAAGAAGGGGAGAGGGAGG + Intronic
992092147 5:73326842-73326864 CCAAAGATAAAGGCCCAGGGAGG + Intergenic
993757932 5:91754383-91754405 CCAGAGATAAGGGTCAAGGGAGG + Intergenic
996653460 5:125911823-125911845 CCATATTTAAACTTAGAGGGGGG - Intergenic
996690346 5:126333735-126333757 CCATGGATAAAAGTGGAGGCAGG - Intergenic
997094182 5:130892127-130892149 CCAAAGAACAAGGTAGAGGTTGG + Intergenic
997827193 5:137116889-137116911 CCACAGAGAAAGGTGGATGGAGG - Intronic
998220690 5:140276397-140276419 GAATTGATAAAGGCAGAGGGAGG + Intronic
999450559 5:151674560-151674582 GCACAGATACAGGTAGAGAGGGG + Intronic
999969752 5:156847520-156847542 CCATAGATAAAGGAGGAGAGTGG + Intergenic
1003518225 6:6835286-6835308 CTATAGATACAGATAGAGTGGGG - Intergenic
1006036611 6:31218088-31218110 CCATGGAGAAAAATAGAGGGAGG + Intergenic
1008414272 6:51221369-51221391 CCATAGATAAGTGTAGAAGAGGG - Intergenic
1009227069 6:61029779-61029801 CCTAATATAAAGGTAGAGAGAGG - Intergenic
1009618398 6:66039989-66040011 TCATAGATAAAGGAGGAGGTAGG - Intergenic
1011270833 6:85578425-85578447 CCACAGAGAAGGGAAGAGGGGGG + Intronic
1012224408 6:96688197-96688219 CCATAAATAAACTTAGAAGGCGG + Intergenic
1014194803 6:118542605-118542627 TCATAGAGTAAGGTAGAGAGAGG + Intronic
1014416471 6:121190498-121190520 CCAGAGATAAAATTAGAGGCGGG - Intronic
1015842328 6:137488846-137488868 CCCTGGATACAGGAAGAGGGCGG + Intergenic
1016767015 6:147806367-147806389 CCAAAGATAAGGCTTGAGGGAGG - Intergenic
1018469375 6:164082294-164082316 CCATGGATTGAGGTGGAGGGAGG + Intergenic
1018648362 6:165969295-165969317 CCAAAGATAGAGGAGGAGGGTGG + Intronic
1018672598 6:166192243-166192265 CCATAGAGAAGGGGAGATGGAGG - Intergenic
1019841429 7:3450041-3450063 CCAGGCATAAAGGTTGAGGGTGG + Intronic
1020859908 7:13478820-13478842 CCATACATAAAGGTGGTAGGGGG + Intergenic
1022097792 7:27151698-27151720 TCAGAGAGAAAGGTAGAAGGGGG - Intronic
1023654655 7:42407289-42407311 CCATACATAATGGGAGATGGAGG + Intergenic
1026305238 7:69134674-69134696 ACAGAGATAGAGGGAGAGGGAGG - Intergenic
1026638103 7:72101923-72101945 CCTTAGATAAAGGTCCAGGAAGG - Intronic
1032127553 7:129205800-129205822 CCAGAGGTGAAGGTACAGGGAGG + Intronic
1032249020 7:130237084-130237106 CCATAGAAAATGTTAGAGGTTGG - Intergenic
1033061060 7:138107978-138108000 CAATAGATAAGGGAAGAGGCTGG - Intronic
1039159397 8:34599913-34599935 CAGTAGAGAAAGCTAGAGGGAGG + Intergenic
1039615511 8:38952081-38952103 CCAGAGATTCAGGCAGAGGGAGG + Intronic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1046547523 8:115669528-115669550 CCACAGATAAAGGGCGGGGGAGG - Intronic
1050003219 9:1100605-1100627 CCAAAGAGAAAGGCAGAAGGTGG + Intergenic
1050685911 9:8169160-8169182 CCCTAAATAAAGGAGGAGGGTGG - Intergenic
1052784155 9:32813219-32813241 CCATAGGTCAAAGTAGAGAGAGG - Intergenic
1055290936 9:74781132-74781154 GCATAAATAAAGGAAGAGGCAGG + Intronic
1055740603 9:79384066-79384088 ACATAGAGGAAGGTAGAGGATGG - Intergenic
1057309017 9:93930032-93930054 CTAAAGATAAAGGCAGAGGTTGG + Intergenic
1058642811 9:107103653-107103675 CCATGGATAAAAGCAGAGGGAGG - Intergenic
1059806037 9:117801581-117801603 TGATAGATAAAGGAAGAGAGAGG + Intergenic
1185569838 X:1126558-1126580 ACAGAGCTAAAAGTAGAGGGTGG + Intergenic
1187697326 X:21935491-21935513 CCATAGAGACAGGAAGCGGGGGG - Intergenic
1188275000 X:28189557-28189579 ACATAGATGAAGGAAGAGAGAGG - Intergenic
1188493468 X:30759384-30759406 CAAGAGAAAAAGGTAAAGGGTGG + Intergenic
1193275657 X:79584309-79584331 CCCTAGTTAAGGGTAGAAGGAGG - Intergenic
1193667087 X:84334013-84334035 CATCAGTTAAAGGTAGAGGGAGG - Intronic
1196245921 X:113400364-113400386 CCATACTCAAAGGTTGAGGGTGG + Intergenic