ID: 966754528

View in Genome Browser
Species Human (GRCh38)
Location 3:183355989-183356011
Sequence GAGGTTTGCAAGGCTGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 1, 2: 2, 3: 30, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966754528_966754535 22 Left 966754528 3:183355989-183356011 CCATCTGCAGCCTTGCAAACCTC 0: 1
1: 1
2: 2
3: 30
4: 268
Right 966754535 3:183356034-183356056 CAGGACAGTGCCTAGGCTATAGG 0: 1
1: 0
2: 1
3: 8
4: 175
966754528_966754533 15 Left 966754528 3:183355989-183356011 CCATCTGCAGCCTTGCAAACCTC 0: 1
1: 1
2: 2
3: 30
4: 268
Right 966754533 3:183356027-183356049 GATTTGCCAGGACAGTGCCTAGG 0: 1
1: 0
2: 4
3: 17
4: 132
966754528_966754532 3 Left 966754528 3:183355989-183356011 CCATCTGCAGCCTTGCAAACCTC 0: 1
1: 1
2: 2
3: 30
4: 268
Right 966754532 3:183356015-183356037 CTTCACAAAGTAGATTTGCCAGG 0: 1
1: 0
2: 0
3: 22
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966754528 Original CRISPR GAGGTTTGCAAGGCTGCAGA TGG (reversed) Intronic
901229251 1:7632897-7632919 GAGGTGCTCCAGGCTGCAGAGGG - Intronic
901384206 1:8896498-8896520 GAGGTATCCAAGGAAGCAGAGGG - Intergenic
901720010 1:11189498-11189520 GAGGTCTGCAAAGCTGCAGCAGG - Exonic
902761175 1:18581623-18581645 GAGGGCTGCAGGGCTGCGGAAGG - Intergenic
902919959 1:19659844-19659866 GGGGACTGCAAGGCTGCAGGCGG + Intergenic
904197829 1:28799217-28799239 GATGTTTGCAAGTGTGCTGAAGG - Intergenic
904925906 1:34048085-34048107 GAGGTTGGCAAGGATGGAAATGG + Intronic
904963675 1:34355007-34355029 GGCTTTTGCAAGGCTGAAGAGGG + Intergenic
906319770 1:44808735-44808757 GAGGTTAGCAAGGCCTGAGAGGG - Exonic
907924075 1:58939854-58939876 AAGATTTGCAGGGCTGCAGGGGG - Intergenic
908374771 1:63524018-63524040 GAGGTTTCCAAGCCTGCGGGGGG + Intronic
909595326 1:77399816-77399838 GAGGTTTAGAAGGCTGCTGTGGG + Intronic
909946764 1:81672166-81672188 GAGTTTTAGAAGGCTACAGAAGG - Intronic
910178071 1:84452531-84452553 GAGATCTGCAATGCTGCTGAAGG - Intergenic
910362627 1:86429359-86429381 GAGGTCTGAACTGCTGCAGAAGG + Intronic
911333642 1:96555005-96555027 GAAGTTTGCAAGGCTGTGGAGGG - Intergenic
912551194 1:110486510-110486532 GAGGGCTGCAGGCCTGCAGAGGG + Intergenic
916553797 1:165875564-165875586 CAGGTTTGCATGTCTGCAGGGGG - Intronic
919751508 1:201040820-201040842 GAGATTCTCAGGGCTGCAGAAGG + Intronic
922545866 1:226456302-226456324 GAGGTTTCCTGTGCTGCAGAAGG - Intergenic
922985735 1:229864864-229864886 GAGGGCTCCAAGGCTGCAGGAGG + Intergenic
924168877 1:241316192-241316214 GAGGGTGGCATGCCTGCAGAGGG - Intronic
1062937921 10:1401523-1401545 GAGGATTCCAAGGCTGCACCTGG - Intronic
1063216374 10:3929685-3929707 GACATTTACAAGCCTGCAGAAGG + Intergenic
1063865916 10:10365357-10365379 AAGGTTTGAAGGGCTGCAGCTGG + Intergenic
1064055454 10:12093427-12093449 GCAGTTTGGAAGGCTGAAGAGGG - Intronic
1064933087 10:20649360-20649382 AAGGTTTGCAAAACTCCAGATGG + Intergenic
1065189821 10:23198996-23199018 GAGGGCTGAAAGGCGGCAGAAGG - Intergenic
1065332641 10:24618647-24618669 GAGGCTGGTGAGGCTGCAGATGG + Intronic
1065698616 10:28403239-28403261 GTGCTTTGCAAGGCTGAAGTGGG + Intergenic
1068518393 10:58051788-58051810 GAGGTCTGAAAGGGTGCCGAGGG - Intergenic
1068816936 10:61326803-61326825 GATGTTTGCAAGTCTGATGAGGG + Intergenic
1070644612 10:78193023-78193045 AAGGGTTGCAAGGGTGCAAAGGG - Intergenic
1071105651 10:82091332-82091354 GAGGTTACCATGGCTGCAGGTGG - Intronic
1072809193 10:98446439-98446461 GAGGTTTGCTGGGGTCCAGATGG - Intronic
1073069699 10:100785506-100785528 GCAGGTTGCATGGCTGCAGATGG + Intronic
1073343346 10:102762871-102762893 CAGGTGAGCAAGGCTGCTGAGGG + Intronic
1073930334 10:108567266-108567288 GTTCTCTGCAAGGCTGCAGATGG - Intergenic
1075219771 10:120575036-120575058 GGGGTGTGCAAGACGGCAGACGG + Intronic
1075764256 10:124880049-124880071 GAGGTTTGCAAAGCAGCGGTGGG + Intergenic
1076441079 10:130481759-130481781 CAGGTTTGCTCGCCTGCAGAGGG + Intergenic
1076796682 10:132801751-132801773 CACGTGAGCAAGGCTGCAGAGGG - Intergenic
1077552206 11:3205572-3205594 GGAGTTTGCATGGCTGCAGTGGG - Intergenic
1078159530 11:8828667-8828689 GAGGTGAGCAAAGCTCCAGAAGG + Intronic
1078986219 11:16602486-16602508 GAGGTTTTCAAAACTGTAGAAGG + Intronic
1079098139 11:17524255-17524277 GAGCTGGGGAAGGCTGCAGAAGG + Intronic
1079302614 11:19291880-19291902 GATGTTTCCAAGGCAGCACATGG + Intergenic
1079991244 11:27249084-27249106 GGCGATAGCAAGGCTGCAGAGGG - Intergenic
1081983696 11:47286457-47286479 GAGGTTTGAAAGACTGAAGCTGG - Exonic
1083473068 11:62897327-62897349 GAGATGGGGAAGGCTGCAGAAGG + Intergenic
1083487715 11:62993866-62993888 ACGGTCTGCAAGTCTGCAGAGGG + Exonic
1083874223 11:65512074-65512096 GTACTTTGGAAGGCTGCAGAGGG + Intergenic
1084318443 11:68359470-68359492 GAGGATAGAAAGGCTGCAGCTGG + Intronic
1085298135 11:75442495-75442517 GAGCTCTGCCAGGCTGCAGATGG + Exonic
1087898040 11:103609614-103609636 GAGGACTGCAAGGCTGGAGAAGG - Intergenic
1088993737 11:114977951-114977973 GAGTTTTAATAGGCTGCAGAAGG + Intergenic
1090422087 11:126582344-126582366 GAGCTTAGCAAGGCTGGTGAAGG - Intronic
1091689918 12:2588924-2588946 GAGGCTTTCATTGCTGCAGAGGG + Intronic
1091738342 12:2941684-2941706 GAGCTTAGCAAGGCCACAGAGGG + Intergenic
1096519635 12:52177358-52177380 GAGGTGTGCCTGGCTGCAGGGGG + Intronic
1097263937 12:57735502-57735524 GGGGGTTGGAAAGCTGCAGAGGG - Intronic
1101439433 12:104692446-104692468 GAGGTTTGTAAGGCTTCAGTGGG - Intronic
1101736586 12:107467872-107467894 GAGGCTTGCCTGGCTTCAGAGGG + Intronic
1102228744 12:111247843-111247865 GAGGTTGGCCAGGCCACAGACGG - Intronic
1103249166 12:119485312-119485334 GATTTTTGCCAGGCTGCAGGTGG + Intronic
1103572542 12:121854702-121854724 GAAGTTTGCTGTGCTGCAGACGG - Exonic
1103895844 12:124272585-124272607 GAGGCTGGTAAGGCTGCAAATGG + Intronic
1104229870 12:126874394-126874416 CAGGCTTCCAGGGCTGCAGAGGG + Intergenic
1104733367 12:131121265-131121287 CAGGACTCCAAGGCTGCAGAGGG + Intronic
1105885756 13:24639679-24639701 GAAGTTTGCAAGTTTGCAGTGGG - Intergenic
1107355285 13:39559711-39559733 GAGGAGTGCCAGGCTGCAAATGG + Intronic
1110928772 13:81188546-81188568 AAAGTTTCCAAGGCAGCAGAAGG - Intergenic
1113061012 13:106322846-106322868 CAGGGTTCCAAGGCTGCACAGGG - Intergenic
1113749760 13:112769077-112769099 AAGGTTTGCAAGTCGGGAGACGG + Intronic
1115053415 14:29092633-29092655 GGGGTTTGTAAGGCTGCATTTGG - Intergenic
1115086580 14:29523406-29523428 GAGCTTTGGAAGGCTGAAGTGGG + Intergenic
1116386057 14:44331483-44331505 CAGTTCTGCATGGCTGCAGAGGG + Intergenic
1116955738 14:50921207-50921229 GAGGGTCTCAGGGCTGCAGAGGG + Intronic
1117755894 14:58973639-58973661 GAAGTATGGAAGGCTGCGGAAGG + Intergenic
1117802539 14:59459879-59459901 GAGATTCCCAAGGCTGGAGAAGG + Intronic
1118899121 14:69972150-69972172 AAGCTTTTCAAGGCTGCAGAAGG + Intronic
1121066025 14:90965817-90965839 TAGGTTAGTAAGGGTGCAGATGG + Intronic
1121823372 14:96990041-96990063 GGGGGTGGCAAGGCTACAGAAGG - Intergenic
1122807620 14:104268162-104268184 GAGGTTTGTGAAGCTGCAGAGGG - Intergenic
1123200148 14:106655771-106655793 TAGGTTTGACAAGCTGCAGAGGG - Intergenic
1123217580 14:106826132-106826154 CAGGTTTGACAAGCTGCAGATGG - Intergenic
1123435287 15:20249734-20249756 GAGGGGTGCAGGCCTGCAGAGGG - Intergenic
1123435292 15:20249752-20249774 CAGGTGTGCAGGCCTGCAGAGGG - Intergenic
1123484429 15:20675202-20675224 GAGGTTGGAAAGGCAGCAAAAGG - Intergenic
1123537156 15:21244169-21244191 GAGGTTGGAAAGGCAGCAAAAGG - Intergenic
1125209150 15:37191879-37191901 GAGATTTGAAAGGGTGGAGAGGG - Intergenic
1125653689 15:41338505-41338527 CAGGTTTGCAGCGCTGGAGATGG - Intronic
1129435267 15:75534599-75534621 TAGGATGCCAAGGCTGCAGAGGG + Intronic
1130996866 15:88908906-88908928 GAGGTTTGCTGGCCTCCAGAAGG - Intronic
1131132365 15:89908476-89908498 GAGGTTGGCGGGGCTGCAGCCGG - Intronic
1132153686 15:99480204-99480226 GAGGACTGGAAGGCTGCACAGGG - Intergenic
1132574878 16:659712-659734 GAGGCTGGCAGGGCTGGAGACGG + Intronic
1132841758 16:1981455-1981477 GAGGCGTGCAAGACTGAAGAAGG + Exonic
1133087783 16:3378526-3378548 CAGGTTTCCCAGGGTGCAGAGGG - Intronic
1133888830 16:9858831-9858853 GATGTTGCCAAGGCTGCAAAAGG + Intronic
1133907743 16:10037414-10037436 GAGGGTGGCAGGGCTGCACACGG - Intronic
1134175531 16:12003077-12003099 GAGGTTGGAAAGGCGGCAGAAGG + Intronic
1134175541 16:12003128-12003150 GAGGTTGGAAAGGCGGCAGAAGG + Intronic
1136849321 16:33601238-33601260 CAGGTGTGCAGGACTGCAGAGGG + Intergenic
1137615926 16:49846932-49846954 GAGGTGGGCATGGCTGGAGAGGG - Intronic
1203111028 16_KI270728v1_random:1449888-1449910 CAGGTGTGCAGGACTGCAGAGGG + Intergenic
1143203389 17:5127257-5127279 AAGGTTTGTCAGCCTGCAGAGGG - Intronic
1144095782 17:11899670-11899692 GGGGGTTGCAGGACTGCAGAAGG + Intronic
1144354262 17:14429091-14429113 GAAGTTTCCAAGGCTGAAGGTGG + Intergenic
1145734107 17:27214413-27214435 GGGGTTTGCATGGTTTCAGAAGG - Intergenic
1148099221 17:45077770-45077792 GAGTTGTCCTAGGCTGCAGATGG + Intronic
1148135040 17:45286751-45286773 GAGGTTTCCAGGGCTGGAGAGGG + Exonic
1148819447 17:50352160-50352182 AGGGTTTACAAGGCTGGAGACGG + Intronic
1150122690 17:62617154-62617176 GAGGGGTCCAGGGCTGCAGAAGG + Intergenic
1151800598 17:76377145-76377167 GAATTCTGCCAGGCTGCAGATGG + Intronic
1153564086 18:6401829-6401851 GCGGTGTGCAAGGGTGCAGTAGG + Intronic
1154062221 18:11072711-11072733 GAGGTTTGCACCACTGCAGTCGG + Intronic
1155915005 18:31548678-31548700 TAGGTTTCCAAGGCTGCTCAAGG - Exonic
1156142880 18:34138163-34138185 GTGCTTTGGGAGGCTGCAGAAGG + Intronic
1157304477 18:46507224-46507246 GAGGGGTGCCAGGCAGCAGAAGG + Intronic
1157797989 18:50593312-50593334 AAGGATTGCCAGCCTGCAGATGG - Intronic
1158509224 18:58075677-58075699 GAGGTTTGGAAGGCTGAGGCGGG + Intronic
1160339184 18:78071940-78071962 GAGGTTTGCATGGCTGAGGCTGG + Intergenic
1161065180 19:2233976-2233998 GGTGTGTGCAGGGCTGCAGAGGG - Exonic
1161584730 19:5099135-5099157 GAGGATTGCAGGGCACCAGAAGG + Intronic
1161957548 19:7504930-7504952 GGGGGTTGCAAGGCCCCAGATGG + Intronic
1162410054 19:10500205-10500227 GAAGTTTGCAAGTTTGCAAATGG - Intronic
1162432915 19:10639910-10639932 GAGGTTAACAAGGCTGTGGAGGG + Intronic
1163427606 19:17247716-17247738 CAGGTGTTCAAGGCTGCAGTGGG + Intronic
1165661296 19:37582675-37582697 AGGGTTTGGAAGGCTGGAGAAGG - Intronic
1165800160 19:38544373-38544395 GACATTGGCAAGGCTGCAAAGGG - Intronic
1166121581 19:40690344-40690366 GAGGGTGCCAAGGCTGGAGAGGG - Intronic
1166533321 19:43555379-43555401 AGAGTTTGCAAGGCTGCAGGAGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167045750 19:47047923-47047945 GAGGTGATCTAGGCTGCAGAGGG - Intronic
1167079698 19:47270699-47270721 GGGGTATGCAAGCCCGCAGAAGG - Intronic
1167861108 19:52284809-52284831 GATGTTTCCAAGGATACAGATGG + Intronic
1168485460 19:56758717-56758739 GAGATTTGCATGTGTGCAGAAGG + Intergenic
1168493905 19:56834655-56834677 GAGGTTTCCAAGTCTCCACAGGG + Intronic
925417585 2:3681846-3681868 GACGTTTGCAAGGCCACAGTGGG - Intronic
925981728 2:9182564-9182586 GTGCTTTGGGAGGCTGCAGAGGG - Intergenic
926008461 2:9390451-9390473 GAGGTTTGTGAGGCAGAAGAAGG + Intronic
927226243 2:20768103-20768125 GAGGTTTGCAGACATGCAGAGGG - Intronic
927765452 2:25803197-25803219 GAGGGTGGCAAGCCTGGAGAGGG + Intronic
928201036 2:29247582-29247604 GAGGTGGGCAAAGCTGTAGAGGG + Intronic
929306838 2:40372982-40373004 GGGGATTGCAAGGCTGCTGTTGG - Intronic
932562009 2:72881423-72881445 GAGGTGGGGAAGACTGCAGAAGG - Intergenic
932585517 2:73025668-73025690 GCGGTTGGCAATGCTGCAGAGGG + Intronic
933636158 2:84711117-84711139 GAGGTTTGAAAGGGTAAAGAGGG + Intronic
933730395 2:85451903-85451925 GAGTTTGGTAAGGCTGCAGAAGG - Intergenic
935173843 2:100630801-100630823 GCTGTTTGCAAAGCTGCAGAAGG - Intergenic
935706107 2:105859221-105859243 GGGCTTTGCAAGGCTCCAGCTGG - Intronic
936032580 2:109084133-109084155 GAGTTTTGAGAGGCAGCAGAAGG - Intergenic
937324667 2:120983367-120983389 GATGTTTTCACAGCTGCAGAGGG - Intronic
937883655 2:126886197-126886219 CTGGTTTGCAAGGCTGCGGAAGG - Intergenic
938115044 2:128596936-128596958 GCAGGTTGCAAGGCTGGAGAAGG - Intergenic
938406980 2:131038260-131038282 GAGGGCTGCAAGGCTGCAGGAGG - Intronic
938406995 2:131038322-131038344 GGGGGCTGCAAGGCTGCAGGAGG - Intronic
938407013 2:131038382-131038404 GAGGGCTGCAAGGCTGCAGGAGG - Intronic
938407034 2:131038473-131038495 GAGGGCTGCAAGGCTGCAGGAGG - Intronic
938407052 2:131038535-131038557 GGGGGCTGCAAGGCTGCAGGAGG - Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938799085 2:134743627-134743649 GAGTTCTGGAAGGCTGCAGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942749029 2:179267200-179267222 AATGTTTACAAGGCTGCATATGG - Intergenic
944457112 2:199907052-199907074 TAGTTCTGCATGGCTGCAGAGGG + Intergenic
944863139 2:203834501-203834523 GAGAACTGCAAGGCTGAAGAAGG - Intergenic
944924706 2:204452644-204452666 GTCGTTTCCATGGCTGCAGATGG - Intergenic
945426735 2:209714426-209714448 CAGGTTAGCTAGGCTACAGATGG + Intronic
948174870 2:235935257-235935279 GCGGCTTGCAAGCCGGCAGACGG - Intronic
948191026 2:236058954-236058976 CAGGATTTCAAGGCTGCAGTGGG + Intronic
948976681 2:241467817-241467839 GAGGATGGGAAGGCTGCAGCTGG - Intronic
1168766983 20:388362-388384 AAGGATTGCCAGGGTGCAGAGGG + Intronic
1169270498 20:4195640-4195662 GAGGTTCTTCAGGCTGCAGATGG + Intergenic
1169657401 20:7940666-7940688 GAGGTTGGGAAGGCAGCAGAAGG + Intergenic
1170629255 20:18054337-18054359 GGGGTGTGCAAGGCAGCAGGAGG - Intronic
1171312356 20:24154902-24154924 GGGGTTTTCAAGGTAGCAGATGG + Intergenic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1172884593 20:38222640-38222662 GAGCCTTGGAAGGTTGCAGAGGG - Intronic
1173387246 20:42600031-42600053 TAGGTTTTGAAGGCTGCAGAGGG - Intronic
1174014996 20:47480729-47480751 GAGCTTTGGAAGGCTGAAGCTGG + Intergenic
1174136215 20:48381923-48381945 GAGGTGTGGAAGGGTGAAGAGGG + Intergenic
1174183608 20:48690302-48690324 GAGGGTTGCAATGCTACAGGAGG - Intronic
1175250815 20:57609259-57609281 GAGGATTCCAACTCTGCAGAAGG - Intronic
1179536338 21:42055254-42055276 GAGGTATGACAGGCTGCAGATGG + Intergenic
1181806791 22:25379717-25379739 GAGGATAGAAAGGCTGCAGCTGG - Intronic
1181844328 22:25694518-25694540 CAGGTTTCAAAAGCTGCAGAAGG - Intronic
1183352090 22:37340104-37340126 GAGTTTTGCTGAGCTGCAGAAGG - Intergenic
1183873206 22:40756174-40756196 GAACTTTGGAAGGCTGCAGTGGG + Intergenic
1184814972 22:46862351-46862373 GAGGCTTGAATGGTTGCAGATGG + Intronic
952685551 3:36143883-36143905 AATGTGTGCAAGGGTGCAGAAGG - Intergenic
953577683 3:44126412-44126434 GAGGTTTGCATGGGGGCAGGAGG - Intergenic
953690273 3:45112096-45112118 GCGGTTTGCAATGCTGAAGCCGG + Exonic
954297369 3:49681744-49681766 GAGGGCTGCCAGGCTGCAGCAGG - Exonic
954869341 3:53755923-53755945 AAGGTTGTCAAGGCTGCAGAAGG + Intronic
956223604 3:66931360-66931382 GAGGTTTTTCAAGCTGCAGAGGG - Intergenic
956401830 3:68887729-68887751 GAGAATTCCAAGGCTGCATAGGG + Intronic
957129227 3:76201742-76201764 GAAGTTTGCTGGGCTGCACAGGG + Intronic
958168301 3:89905835-89905857 GAGGCTTACAAGTCTGGAGAGGG + Intergenic
959942916 3:112098155-112098177 GAGGTTTGGGAGTCTGCAGGAGG - Intronic
960287933 3:115850786-115850808 GAGGTCTGCAAGGCTGGAGAAGG + Intronic
961571892 3:127805201-127805223 GAACTTTCCAAGGCTGCAGATGG + Intronic
961866059 3:129954375-129954397 GAGGCTGGCAAGGCTACCGAAGG - Intergenic
963988677 3:151627866-151627888 GAGGTATGGAAGCCTTCAGATGG - Intergenic
964458997 3:156901069-156901091 GGGGTTGGCGAGGCTGCAGTGGG - Intronic
964703653 3:159595517-159595539 AAGGTTTGCATGGCTCCTGAAGG - Intronic
965533987 3:169805521-169805543 GAGGTTTGGAAGACTTAAGATGG + Intronic
965729312 3:171753944-171753966 GAGGAACGCAAAGCTGCAGACGG - Intronic
966296922 3:178434630-178434652 GATGTTTTCAAGGCAGCAGATGG + Intronic
966754528 3:183355989-183356011 GAGGTTTGCAAGGCTGCAGATGG - Intronic
968775031 4:2535619-2535641 GATGTCTGCAAGGCCGCGGAGGG + Intronic
968971195 4:3796120-3796142 GAGGTTTGCCAGGCTGGAGCTGG - Intergenic
969510834 4:7616966-7616988 GAGCTTTGCAGGGCTCCAGCAGG + Intronic
969565027 4:7972246-7972268 GAGGCGTGCAAGGCTGTGGAGGG - Intronic
970890240 4:21035761-21035783 GAGCTTAGCAAGGCAGCAAAAGG - Intronic
971171043 4:24233018-24233040 AAGGATCCCAAGGCTGCAGAGGG + Intergenic
974676467 4:65096136-65096158 GAGGTTTTCTAGGCGTCAGATGG - Intergenic
976862947 4:89688339-89688361 GAGGTGGGCAAGCCTGAAGAGGG + Intergenic
977516567 4:98027532-98027554 TAGTTTTGCAAGTCTACAGATGG - Intronic
977727844 4:100318246-100318268 GAGTTTTGCTGGGCTGCAGTGGG - Intergenic
978372939 4:108047265-108047287 GAGGGTTGCCAGGATTCAGATGG - Intergenic
978558650 4:110008209-110008231 GAGGATGGCCAGGCAGCAGATGG + Exonic
980880693 4:138707359-138707381 GAGCTTTGCAAGGCTCTTGATGG - Intergenic
981880568 4:149606140-149606162 CTGGTTTGCAAGGCTTCAGCTGG + Intergenic
982405761 4:155018541-155018563 GAGGTTTAGAACTCTGCAGAAGG + Intergenic
984193145 4:176628146-176628168 CAGGTCAGGAAGGCTGCAGAGGG + Intergenic
984421224 4:179524569-179524591 GAAGTTGGCAAGGGTGGAGAAGG + Intergenic
984646904 4:182230433-182230455 GAGGTTCGCCAGGGTTCAGAAGG - Intronic
986408337 5:7449115-7449137 GATGCTGGCAAGGTTGCAGAGGG - Intronic
995519173 5:112984776-112984798 GAGGTGTTCAAGGCTGCAGTGGG - Intronic
995855367 5:116586035-116586057 GAGGTTTGAAAGGCAAGAGATGG - Intergenic
997283028 5:132660435-132660457 GAGGTCGGCTAGGCTGAAGACGG - Exonic
997377434 5:133407166-133407188 GAGGTTTGCAGGGCTGCAGAAGG + Intronic
999269025 5:150285653-150285675 GGGGTTGCCAAGGCTGCAGTTGG - Intronic
999295471 5:150457038-150457060 GAGGTGTGCCAGGGGGCAGATGG + Intergenic
1001603271 5:172943018-172943040 CAGGTTTGGGAGGCTGCAAAGGG - Intronic
1002193592 5:177491026-177491048 GAGGTGGGCAAGGATGCGGAAGG + Exonic
1003150029 6:3540556-3540578 GAGGTTTGGGGGTCTGCAGACGG - Intergenic
1003282451 6:4705808-4705830 GTGGTTTTCAAACCTGCAGATGG - Intergenic
1003793191 6:9570247-9570269 GAGGTTTGAGAGGATACAGAAGG - Intergenic
1007276170 6:40675557-40675579 CAAGTTTGGAGGGCTGCAGAGGG - Intergenic
1007420423 6:41715891-41715913 GATGTCTGCAAGGCTGCAGTGGG - Intronic
1007608285 6:43132006-43132028 GAGGTGTGGGGGGCTGCAGAGGG - Exonic
1011323146 6:86119299-86119321 GAGATTTGAAAGGCAGAAGAGGG + Intergenic
1011613657 6:89178623-89178645 TAGCTTTGGAAAGCTGCAGAAGG + Exonic
1011847330 6:91582338-91582360 GAGGATTGGAAGGATGCAGAAGG - Intergenic
1018659868 6:166076245-166076267 GCTCTTTGCAAGGCTGCAGCTGG + Intergenic
1019522828 7:1468345-1468367 GAGGCTGGCGAGGCTGCAGCAGG + Intergenic
1019915483 7:4129613-4129635 GTGGTTGGCATGGCTGCAGTTGG + Intronic
1019974492 7:4569850-4569872 GTGGTATGAAAGGGTGCAGATGG + Intergenic
1020450641 7:8316984-8317006 GACGTAGGCAAGGCTGCAGGGGG - Intergenic
1021138733 7:16996818-16996840 AATGCTGGCAAGGCTGCAGAGGG - Intergenic
1021315454 7:19143701-19143723 GCGTTTTGCAAGGCGTCAGAAGG + Intergenic
1022175323 7:27866930-27866952 GAGGAATGCAAGGTTGGAGATGG + Intronic
1025806316 7:64837383-64837405 GGGCTTTGGAAGGCTGCAGTTGG + Intergenic
1027393546 7:77729243-77729265 GAGGTCTGTATGGCTGCAGTTGG + Intronic
1030146094 7:106357604-106357626 TAGGTGGGCAGGGCTGCAGAGGG - Intergenic
1030757193 7:113301349-113301371 GTGGTTTCCAAGCATGCAGAGGG - Intergenic
1032236707 7:130130664-130130686 GAGGTTTGCAAGGTTAGGGAAGG - Exonic
1034237537 7:149584438-149584460 GAGGTGTGCTAGGCTGGGGATGG - Intergenic
1034968090 7:155403849-155403871 GAGGTATGGGAGGCTGCAGTGGG - Intergenic
1036404936 8:8446296-8446318 GAGATCTGCATGGCTGCAGTGGG + Intergenic
1042963036 8:74322454-74322476 GAGGTTTGCAAGGAGGAATATGG + Intronic
1046037771 8:108864656-108864678 GATGTTTGGCAGGCTGCAGCTGG + Intergenic
1047242431 8:123103710-123103732 AAGGTTTGCAAGGCTGGACACGG - Intronic
1047819466 8:128502750-128502772 GAGGTTTTCACTGTTGCAGAGGG - Intergenic
1048315526 8:133359060-133359082 GAGTTTGGCAAGGCTGCACTGGG - Intergenic
1049327336 8:142029760-142029782 GAGGTTTGAGAGGCCGCAGGAGG + Intergenic
1049755039 8:144307400-144307422 TTGGTTTTTAAGGCTGCAGATGG + Intronic
1051165933 9:14261949-14261971 GAGGATTGCAAGGCAGGAGGTGG + Intronic
1052372309 9:27679039-27679061 TAGGTCTGCAAAGCTGTAGAAGG - Intergenic
1052769136 9:32671521-32671543 GAGCTTTGAAAGGCTGCAGATGG - Intergenic
1052776973 9:32742041-32742063 GACATTTGCAAGTCAGCAGAAGG + Intergenic
1053351187 9:37414405-37414427 GTGGGGTGCAAGGCTGCAGCAGG + Intergenic
1055002150 9:71463643-71463665 GTAGTTTGTAAGGCAGCAGAAGG - Intergenic
1056392144 9:86150240-86150262 GAGGTATCCAAGGAAGCAGAAGG + Intergenic
1059511801 9:114855237-114855259 GAGGTCTGGAAGGGTCCAGATGG + Intergenic
1059921783 9:119168038-119168060 GATGTTGGCCAGGCTGCACATGG + Exonic
1060116798 9:120948114-120948136 GAGATTAGGAAGGCTGCAGATGG - Intergenic
1060927014 9:127462114-127462136 GAGGTTTCCTAGGCTCAAGAAGG - Intronic
1061579743 9:131529748-131529770 GTGGTCTGCAGGGCTGCAGAGGG - Intronic
1187012950 X:15298527-15298549 GAAGTCTGCTAGGCTGCGGAGGG + Intronic
1189011362 X:37048816-37048838 GAAGTCTGCAAGGCTGCTGCAGG + Intergenic
1190816884 X:53937446-53937468 GGGGATTTCAAGGCAGCAGAGGG - Exonic
1191636790 X:63387083-63387105 TATGTGTGCAAGGCTGGAGAGGG - Intergenic
1191675256 X:63785894-63785916 GAGGCTTGGAAAGCCGCAGAGGG - Intergenic
1192674607 X:73182790-73182812 CGGGTTTGCCAAGCTGCAGAGGG - Intergenic
1193135285 X:77964355-77964377 GTGCATTGAAAGGCTGCAGATGG + Intronic
1193949350 X:87778817-87778839 CAGCTTTGCCAGGCTGCAGTGGG - Intergenic
1196155325 X:112422323-112422345 GAGGTATGCAGCACTGCAGATGG + Intergenic
1196193229 X:112815357-112815379 GAAGGTGGCAAGACTGCAGAAGG - Exonic
1197643717 X:128994365-128994387 GAGGTTTGGAAGGGTGTGGAAGG + Intergenic
1197762703 X:130038969-130038991 GAGAGTTGCAAGGCTACAGGTGG + Intronic
1197982272 X:132229173-132229195 GAGATTTTTAAGACTGCAGAAGG - Intergenic
1199105220 X:143858423-143858445 GGTGTTGGCAAGGTTGCAGAGGG + Intergenic
1199236986 X:145503837-145503859 GAGCTTTTCCAGGCTGCTGAGGG - Intergenic
1199819279 X:151428614-151428636 GAGATGTGGAAGTCTGCAGATGG - Intergenic
1201297631 Y:12477935-12477957 GCACTTTGCAAGGCTGAAGAGGG + Intergenic
1201496023 Y:14592134-14592156 GAGGTTTCCAAGGAAGCAGGAGG + Intronic