ID: 966755935

View in Genome Browser
Species Human (GRCh38)
Location 3:183371397-183371419
Sequence GAGGGGGGTTTCCAGTTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 618
Summary {0: 1, 1: 0, 2: 5, 3: 97, 4: 515}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966755925_966755935 16 Left 966755925 3:183371358-183371380 CCATTAGTCATTCAGGAAAGGCA 0: 1
1: 1
2: 5
3: 49
4: 379
Right 966755935 3:183371397-183371419 GAGGGGGGTTTCCAGTTCATAGG 0: 1
1: 0
2: 5
3: 97
4: 515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966755935 Original CRISPR GAGGGGGGTTTCCAGTTCAT AGG Intronic
901359489 1:8684691-8684713 GAGGTGGGTTAACAGCTCATAGG - Intronic
902093650 1:13924661-13924683 GTAGGGGGCTTCCAGGTCATAGG - Intergenic
902971237 1:20052924-20052946 GGAGGGGGCTTCCAGGTCATAGG - Intronic
902997762 1:20240190-20240212 GTGGGGAGCTTCCAGGTCATAGG - Intergenic
903117536 1:21190601-21190623 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
903393693 1:22983067-22983089 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
903840654 1:26236837-26236859 GGTGGGGGCTTCCAGGTCATAGG + Intronic
906562769 1:46771393-46771415 GGAGGGGGCTTCCAGGTCATAGG - Intronic
908880163 1:68723022-68723044 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
909194965 1:72607675-72607697 GTGGAGGGCTTCCAGGTCATTGG - Intergenic
909576329 1:77180718-77180740 GGGGGGGGCTTCCAGGTCATAGG + Intronic
909828922 1:80160783-80160805 GAGGAGGGTTTACAAGTCATAGG + Intergenic
910203252 1:84721991-84722013 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
910841021 1:91561308-91561330 GAGGGGTGTTTCTACTTGATGGG - Intergenic
910880286 1:91917004-91917026 CAGGGGGGCTTCCAGGTCATAGG + Intergenic
911317237 1:96370087-96370109 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
911408143 1:97467387-97467409 GCAGGGGGCTTACAGTTCATAGG - Intronic
912124845 1:106523013-106523035 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
912563114 1:110564321-110564343 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
912861660 1:113219103-113219125 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
913173637 1:116254694-116254716 GCGGGGGCTTTCCAGGCCATAGG - Intergenic
915788642 1:158643569-158643591 GAGGTGGGTTTCAACTTAATAGG + Intronic
915983124 1:160435193-160435215 GAGGGGGGCTTCCAGGTCATAGG + Intergenic
916650708 1:166831881-166831903 GACGGGGGCTTCCAGGTCTTAGG - Intergenic
917064133 1:171073510-171073532 GAGGTGGGCTTCCAGGTCATAGG - Intergenic
917097965 1:171418409-171418431 GTGGGGGGCTTCCAGATCACAGG + Intergenic
917099372 1:171430229-171430251 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
917150901 1:171943613-171943635 GCAGGGGGCTTCCAGGTCATAGG - Intronic
918246523 1:182665058-182665080 GAGTAGGGTTTCCACTTAATTGG - Intronic
918720076 1:187841406-187841428 AAGGGGGGCTTCCAGATTATAGG + Intergenic
919303374 1:195799086-195799108 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
919576183 1:199312439-199312461 GAGCTGGTTTTCCAGGTCATCGG - Intergenic
921022249 1:211246707-211246729 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
921343698 1:214159870-214159892 GAAGGGGGCTTCCAGGTCACAGG - Intergenic
921668515 1:217901235-217901257 GGAGGGGGATTCCAGGTCATAGG + Intergenic
921926814 1:220717531-220717553 GAAGGGGGCTTCCAGGTCACAGG - Intergenic
922174648 1:223187935-223187957 GGGGGTTGTTTCCAGTTCTTGGG - Intergenic
922390618 1:225137943-225137965 TAGGGGGGTCTCCAGTTCTGTGG - Intronic
922673400 1:227532388-227532410 GGGGGTGGTTTCCAGGTCACTGG + Intergenic
922702963 1:227772470-227772492 CAGAGGGGTTTTCAGTGCATGGG - Intronic
922811677 1:228418724-228418746 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
923245451 1:232126750-232126772 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
923755741 1:236789624-236789646 GAAGGGGACTTCCAGGTCATAGG + Intergenic
923803989 1:237238306-237238328 GAGGGGGACTTCCAGGTCATAGG - Intronic
923868409 1:237964462-237964484 GAGGGGGTATTCCAGGTCATAGG + Intergenic
924885374 1:248210030-248210052 GGGTGTGGTTTCCAGTCCATTGG + Intergenic
1063510645 10:6642175-6642197 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1064359347 10:14649620-14649642 GTGGGGGGTGTCCAGGTCACAGG - Intronic
1066277204 10:33880790-33880812 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1067341445 10:45408378-45408400 GAGGGGAGCTTCCAGGTCATAGG + Intronic
1067345270 10:45433672-45433694 GGGGTGGGCTTCCAGGTCATAGG + Intronic
1067855552 10:49789606-49789628 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1068181632 10:53527240-53527262 GATGGGGGCTTCCAGGCCATAGG + Intergenic
1068624785 10:59230823-59230845 CGGGGGGGCTTCCAGATCATAGG + Intronic
1069270399 10:66519627-66519649 GAAGGGGGCTTCCAGGTCATAGG - Intronic
1069585659 10:69599809-69599831 GTTGGGGGCTTCCAGGTCATAGG - Intergenic
1069925830 10:71850414-71850436 GCGGGGGGCTTCCAGGCCATAGG - Intronic
1069953942 10:72038272-72038294 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1070936020 10:80295814-80295836 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1071019501 10:81035490-81035512 GAGGTGGGTTTGCTGTTCACAGG + Intergenic
1071257402 10:83883846-83883868 GTGGGAGGTGTCCAGGTCATGGG + Intergenic
1071287282 10:84160709-84160731 CTGGGGGGCTTCCAGATCATAGG + Intergenic
1071689072 10:87796437-87796459 GGAGGGGGCTTCCAGGTCATAGG - Intronic
1073396022 10:103218223-103218245 GGTGGGGGGTTCCAGGTCATAGG + Intergenic
1074002040 10:109383118-109383140 GAGAGGGGCTTCCAGGTCATAGG - Intergenic
1074821034 10:117178625-117178647 GAAGGAGGCTTCCAGGTCATAGG - Intergenic
1076762129 10:132611145-132611167 GAGGGAGGTTAGGAGTTCATGGG + Intronic
1076822871 10:132949547-132949569 GCGGGGGGCTTCCAGGTCATAGG + Intergenic
1076902284 10:133345715-133345737 GCGGCGGGTGTCCAGGTCATTGG + Intronic
1076997512 11:305782-305804 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1077534057 11:3110761-3110783 GGGAGGGGCTTCCAGGTCATAGG - Intronic
1077534739 11:3118366-3118388 GGAGGGGGCTTCCAGGTCATAGG - Intronic
1077809482 11:5622977-5622999 GAAGGGGGTTTCCAGGTCATAGG + Intronic
1077962165 11:7087202-7087224 GTGGGGGGCTTACAGGTCATAGG - Intergenic
1078222872 11:9365805-9365827 ATGGGGGCTTTCCAGGTCATAGG - Intergenic
1078290360 11:10004858-10004880 GGAGGGGGCTTCCAGGTCATAGG - Intronic
1079163723 11:18017122-18017144 GTGGGAGGTTTCCAGATTATAGG - Intergenic
1081250336 11:40823803-40823825 GAGTGGAGTTTCTAGGTCATAGG - Intronic
1081324798 11:41730832-41730854 GAAGGGGCTTTCCAGGTCATAGG + Intergenic
1081719763 11:45279844-45279866 GAGTGGGGTTAGCAATTCATGGG + Intronic
1081923718 11:46804388-46804410 GAGGGGGGACTCCATTTCAGAGG + Intronic
1083539750 11:63504394-63504416 GAGGTGGGCTTCCAGGTCATAGG - Intergenic
1084744689 11:71161642-71161664 GGGGAGGGTTTCCAGGTCATAGG - Intronic
1085573066 11:77576420-77576442 GGAGGGGGCTTCCAGGTCATAGG - Intronic
1085573892 11:77585361-77585383 GAAGGGGGCTTCCAGGTCATAGG - Intronic
1085678955 11:78552675-78552697 GGAGGGGGCTTCCAGGTCATAGG - Intronic
1086272471 11:85083622-85083644 CAGGGGGGCTTCTAGGTCATAGG + Intronic
1087050189 11:93879005-93879027 GGGAGGGGCTTCCAGGTCATAGG + Intergenic
1087226521 11:95606821-95606843 CAGGGGGCTTTACAGATCATAGG + Intergenic
1087619475 11:100525619-100525641 GGGTGGGGTTTCCAGTTCAATGG - Intergenic
1087993130 11:104770526-104770548 GGAGGGGGCTTCCAGGTCATCGG + Intergenic
1088353215 11:108912930-108912952 GGAGGGGGCTTCCAGGTCATAGG - Intronic
1090096063 11:123742555-123742577 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1090096939 11:123751673-123751695 GTGGGGGGCTTCCAGGTTATAGG + Intergenic
1090100751 11:123794468-123794490 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1090877627 11:130805136-130805158 GACGGGGGCTTCCAGGTTATAGG - Intergenic
1090981339 11:131725098-131725120 GATGGGGGATGCCTGTTCATGGG + Intronic
1091331255 11:134732646-134732668 GAAGGGGGCTTCCAGGTCAAGGG + Intergenic
1091757792 12:3066541-3066563 GAGGGGAGCTTACAGGTCATAGG - Intergenic
1091889692 12:4043698-4043720 GGGGAGGGTTTCCAGGTCCTCGG - Intergenic
1092554216 12:9539241-9539263 TAAGGGGGTTTCCAGGTCATAGG + Intergenic
1093244695 12:16721845-16721867 GTGGGAGGTTTACAGGTCATAGG - Intergenic
1093672007 12:21888113-21888135 CAGAGGGGTTTCCAGGACATGGG + Intronic
1094467675 12:30770976-30770998 GGAGGGGGTTTCCAGGTCACAGG - Intergenic
1094517884 12:31151397-31151419 TAAGGGGGTTTCCAGGTCATAGG - Intergenic
1094527522 12:31242077-31242099 GAGGGGGGCTTACAGGTCATAGG - Intergenic
1094613102 12:32012508-32012530 GAAGGGGGCTTCCAGGTTATAGG - Intergenic
1095147713 12:38750498-38750520 GAGGTGGGTTCCCAGGTCTTGGG - Intronic
1095180485 12:39142519-39142541 GATGGGGGCTTCCAGGTGATAGG - Intergenic
1095209632 12:39477192-39477214 GGGGGGGACTTCCAGGTCATAGG - Intergenic
1095268153 12:40184065-40184087 GTGGGGGACTTCCAGGTCATAGG - Intergenic
1095541363 12:43312046-43312068 GGGAGGGGCTTCCAGGTCATAGG - Intergenic
1095854755 12:46848394-46848416 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1095856702 12:46867496-46867518 GAAGGGGGTTTCAAGGTCATAGG + Intergenic
1095999579 12:48117915-48117937 GAGCGGGGCTTCCAGGTCATAGG + Intronic
1097740312 12:63233972-63233994 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1098408231 12:70150530-70150552 GAAGGGGGCTTCCAGATCATAGG - Intergenic
1098666598 12:73170946-73170968 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1099050993 12:77781491-77781513 GTGGGGAGGTTCCAGGTCATAGG - Intergenic
1099603054 12:84765906-84765928 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1100079846 12:90835351-90835373 GGGAGGGGCTTCCAGGTCATAGG - Intergenic
1100121417 12:91373362-91373384 GGGAGGGGCTTCCAGGTCATAGG - Intergenic
1100755770 12:97749559-97749581 GAGGAGGTGTTCCAGGTCATAGG - Intergenic
1100855238 12:98752075-98752097 GAAGGGGGCTTCCAGGCCATAGG - Intronic
1101108428 12:101462125-101462147 GAGGGAGGGTCCCAGTTCATTGG - Intergenic
1101694033 12:107107718-107107740 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1102008251 12:109602456-109602478 CAGGCTGGTTTCCAGTTCCTGGG + Intergenic
1102770956 12:115475378-115475400 GAGGGGGGTTTCAATCTAATTGG - Intergenic
1103228048 12:119304882-119304904 GAAGGGGGCTTTCAGATCATAGG + Intergenic
1104030779 12:125064670-125064692 GAGGGGGCCTTCCAGGTCATAGG + Intergenic
1105769921 13:23599540-23599562 GAAGGGGGATTCCAGGTCACAGG + Intronic
1105812877 13:24010107-24010129 GGAGGGGGCTTCCAGGTCATAGG + Intronic
1106397336 13:29393850-29393872 GGAGGGGGCTTCCAGGTCATAGG + Intronic
1106439235 13:29750827-29750849 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1107852727 13:44587226-44587248 GGGTGGGGCTTCCAGGTCATAGG + Intergenic
1107949366 13:45447935-45447957 GAAGGGGGCTTCCAGGTCATAGG - Intergenic
1108433710 13:50380584-50380606 GGAGGGGGTTTCCAGGTCATAGG + Intronic
1108607240 13:52052070-52052092 GGGGAGGGCTTCCAGGTCATAGG - Intronic
1109434131 13:62276086-62276108 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1109967575 13:69721243-69721265 GGAGGGGGCTTCCAGGTCATAGG - Intronic
1111648948 13:91065852-91065874 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1113248291 13:108423184-108423206 GAAGGGGTTTTCCACTTCGTAGG - Intergenic
1113732631 13:112652823-112652845 GGAGGGGGCTTCCAGGTCATAGG + Intronic
1113809290 13:113128348-113128370 GGTGGGGGCTTCCAGGTCATAGG + Intronic
1113888371 13:113723521-113723543 GGAGGGGGCTTCCAGGTCATAGG + Intronic
1114147555 14:19994767-19994789 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1114346281 14:21798701-21798723 AAGGGGAGCTTCCAGATCATAGG + Intergenic
1115244416 14:31280584-31280606 GGAGGGGGATTCCAGGTCATAGG - Intergenic
1115303420 14:31910411-31910433 GCAGGGGGCTTCCAGGTCATAGG + Intergenic
1115526258 14:34283582-34283604 GAGTGGGGTTTCCCCTTGATGGG + Intronic
1115532630 14:34341380-34341402 AATGGGGGCTTCCAGATCATAGG + Intronic
1115883315 14:37944978-37945000 TGGGGGGGCTTCCAGGTCATAGG + Intronic
1116093228 14:40335266-40335288 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1116173151 14:41428848-41428870 GAAGGGGGCTTCCAGGTCATAGG - Intergenic
1116267389 14:42711232-42711254 GTGGGAGGTTTCTAGGTCATTGG + Intergenic
1116310661 14:43322250-43322272 GGGGTGGGCTTCCAGGTCATAGG + Intergenic
1117419318 14:55528570-55528592 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1118089443 14:62456784-62456806 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1118441260 14:65813810-65813832 GAGGAGGGCTTCCAGATTATAGG + Intergenic
1118753113 14:68820713-68820735 GAGGGTGGTTTCCAGGGCCTGGG - Intergenic
1118938923 14:70314691-70314713 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1119042675 14:71289228-71289250 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1119789649 14:77338525-77338547 GATGGGGGTTTCCAGGTCAGAGG - Exonic
1119796285 14:77400571-77400593 GGCGGGGGTTTCCAGGTCATAGG + Intronic
1120216253 14:81683510-81683532 GCGGGGGGCTTCCAGGTCACAGG - Intergenic
1120389966 14:83893951-83893973 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1120407324 14:84105390-84105412 GGGGGGGTCTTCCAGGTCATAGG - Intergenic
1120409520 14:84134704-84134726 GCAGGGGGCTTCCAGGTCATAGG + Intergenic
1122351479 14:101096103-101096125 GAGAGGGGCTTCCAGATCATAGG - Intergenic
1202891849 14_KI270722v1_random:166431-166453 GGGGGGAGCTTCCAGATCATAGG + Intergenic
1124044373 15:26135004-26135026 GGGCGGGGCTTCCAGGTCATAGG + Intergenic
1124074804 15:26434347-26434369 AAGTGGGGTTTACAGGTCATAGG + Intergenic
1124103244 15:26714542-26714564 GGGCGGGGCTTCCAGGTCATAGG + Intronic
1125341379 15:38679000-38679022 GTGAGGGGCTTCCAGGTCATAGG - Intergenic
1126114108 15:45193373-45193395 GGAGGGGGCTTCCAGTTCATAGG + Intronic
1126152483 15:45535901-45535923 GAGGGGGGTTCCCAGGACATGGG + Intergenic
1127947028 15:63765663-63765685 GTGGGGGGCTTCCAGGTCATAGG - Intronic
1127981572 15:64038979-64039001 GGAGGGGGCTTCCAGGTCATAGG - Intronic
1130074302 15:80675521-80675543 GGTGGGGGCTTCCAGGTCATAGG - Intergenic
1131008521 15:88998229-88998251 GGGGGGTGCTTCCAGATCATAGG - Intergenic
1131496509 15:92916095-92916117 GGAGGGGGCTTCCAGGTCATAGG - Intronic
1132788405 16:1671047-1671069 GACCAGGGTTTCCAGTTCAGAGG - Intronic
1133358655 16:5156162-5156184 GGGAGGGGCTTCCAGGTCATAGG - Intergenic
1133361898 16:5180677-5180699 GTGGGGGGCTTCCAGGTCACAGG - Intergenic
1133652242 16:7823194-7823216 GGAAGGGGTTTCCAGGTCATAGG + Intergenic
1133697797 16:8281429-8281451 TGAGGGGGTTTCCAGATCATAGG + Intergenic
1134281983 16:12825188-12825210 GACGGGGGCTTCCAGGTTATAGG + Intergenic
1134334574 16:13286112-13286134 GGAGGGGGCTTCCAGCTCATAGG - Intergenic
1135205518 16:20480648-20480670 GATGGGTATTTCCAGTTTATGGG + Exonic
1135213389 16:20543165-20543187 GATGGGTATTTCCAGTTTATGGG - Exonic
1135593695 16:23724965-23724987 GAGTGGGGTTTCCAGGTCAAAGG - Intergenic
1137513307 16:49120269-49120291 GAAGGGGGTTACCAGATCCTGGG + Intergenic
1137656365 16:50162219-50162241 AAGGGTGGTTTCCAGTTTTTTGG + Intronic
1138633365 16:58317091-58317113 ACTGGGGGTTTCCAGGTCATAGG - Intronic
1140116495 16:72046147-72046169 GGAGGGGGCTTCCAGGTCATAGG + Intronic
1140331083 16:74057522-74057544 GAGGGGAGTTGCCATTTAATGGG + Intergenic
1140874838 16:79141209-79141231 GGAGGGGGCTTCCAGGTCATAGG - Intronic
1141030586 16:80584414-80584436 GAGGGGTAGTTCCAGGTCATAGG - Intergenic
1141066598 16:80919045-80919067 GGAGGGGGCTTCCAGTTCATAGG + Intergenic
1141214439 16:82010634-82010656 GGAGGGGGCTTCCAGGTCATAGG - Intronic
1141583227 16:85014925-85014947 GAGGGGTGCTTCCAGGTCACAGG + Intergenic
1141747482 16:85935472-85935494 GAAAGGGGTTTCCAGGTCACAGG + Intergenic
1141899262 16:86979725-86979747 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1142442893 16:90112202-90112224 GGGGGGGGCTTCCAGGTTATAGG + Intergenic
1142956173 17:3524223-3524245 ACGCGGGGTTTCCAGTCCATGGG - Exonic
1143467251 17:7145811-7145833 GAGAGGGGCTTCCAGATCATAGG - Intergenic
1144034927 17:11356536-11356558 GAGGAGGCTTCCCAGTTCTTGGG - Intronic
1145287287 17:21515401-21515423 GAGGAAGGCTTCCAGGTCATAGG - Intergenic
1145390340 17:22450949-22450971 GAGGAAGGCTTCCAGGTCATAGG + Intergenic
1146441404 17:32898343-32898365 GGGAGGGGCTTCCAGGTCATAGG + Intergenic
1146442048 17:32905758-32905780 GGAGGGGGCTTCCAGATCATAGG + Intergenic
1147512931 17:41087647-41087669 GGAGGGGGCTTCCAGATCATAGG - Intronic
1147513610 17:41095515-41095537 GGGAGGGGCTTCCAGGTCATAGG - Intronic
1147514992 17:41107682-41107704 GGAGGGGGCTTCCAGATCATAGG - Intergenic
1147515714 17:41115805-41115827 GGGAGGGGCTTCCAGGTCATAGG - Intergenic
1149254364 17:54808132-54808154 GAAGGGGGCTTCCAGGTTATAGG - Intergenic
1151798742 17:76364771-76364793 GGGGGTGGTTTCCAGGTCATAGG - Intronic
1152679940 17:81662056-81662078 GGAGGGGGCTTCCAGGTCATAGG - Intronic
1152823999 17:82452494-82452516 TGGGGGGGCTTCCAGGTCATAGG - Intergenic
1154407969 18:14113373-14113395 GGAGGGAGTTTCCAGGTCATGGG - Intronic
1155787296 18:29916448-29916470 GTGGGGGGCTTCCAAGTCATAGG - Intergenic
1156082660 18:33357085-33357107 AATGGGGGCTTCCAGGTCATAGG - Intronic
1156246526 18:35304803-35304825 AGGGGGGGCTTCCAGATCATAGG - Intergenic
1156352023 18:36309978-36310000 GAGGGGTGATTACAGTGCATTGG - Intronic
1156903225 18:42325576-42325598 GTGGGAGGGTTCCAGGTCATAGG - Intergenic
1156942094 18:42780256-42780278 GCAGGGGGTTTCCAGCTCATAGG + Intronic
1157428743 18:47605816-47605838 GAGGGGGGCTTCCAGGCTATAGG + Intergenic
1157615838 18:48987275-48987297 TGGGGGGGTTTCCAGTTCCTAGG + Intergenic
1158628027 18:59088753-59088775 GATGGGAGATTCCAGATCATAGG + Intergenic
1158821409 18:61163336-61163358 GAGGGGGACTTCCAGATTATAGG - Intergenic
1159101397 18:63962880-63962902 GAGGGAGGTTTCCAGTCCTGAGG + Intronic
1159445508 18:68537347-68537369 GAGGGGGGGCTCCAATTCGTAGG + Intergenic
1159445709 18:68539526-68539548 GAGGGGGGGCTCCAATTCGTAGG + Intergenic
1159595141 18:70376037-70376059 TAGGGAGGTGACCAGTTCATGGG + Intergenic
1159595210 18:70376513-70376535 TAGGGAGGTGACCAGTTCATGGG + Intergenic
1159918436 18:74205798-74205820 GGAGGGGGTTTCCAGGTCAGAGG - Intergenic
1161019869 19:2004086-2004108 GGGAGGGGCTTCCAGGTCATAGG - Intronic
1162294341 19:9802814-9802836 GAGTGGGGATTCCAGCTTATAGG - Intergenic
1162340003 19:10086516-10086538 GAGGGGGCTTCGCAGTTCCTGGG + Intronic
1162945626 19:14041713-14041735 CAAGGGGGTTTCCAGAACATGGG - Intronic
1163088308 19:14999353-14999375 TTGGGGGGCTTCCAGGTCATAGG - Intronic
1164823914 19:31270242-31270264 TAAGTGTGTTTCCAGTTCATGGG - Intergenic
1164966949 19:32493438-32493460 GTGGGGGGCTCCCAGGTCATAGG + Intergenic
1165124881 19:33586980-33587002 GGAGGGGGCTTCCAGATCATAGG - Intergenic
1165249748 19:34520351-34520373 TGGGGGGGCTTCCAGTTCTTAGG + Intergenic
1165653503 19:37511859-37511881 GAGGGGGATTTTCAGTCCCTTGG + Intronic
1165691951 19:37870482-37870504 GTGGGGTGTGTCCAGGTCATAGG + Intergenic
1166106008 19:40598345-40598367 GAGGGGGGTGTCCAGCGCGTGGG - Intronic
1166515523 19:43443886-43443908 GGAGGGGGCTTCCAGATCATAGG + Intergenic
1167200997 19:48065279-48065301 GGGGGGGGCTTCCAGGTTATAGG + Intronic
925100743 2:1243328-1243350 GAGGTGGGTGTACAGCTCATGGG + Intronic
925151272 2:1617166-1617188 GACGGGGGCTTCCAGGTCATAGG - Intergenic
926211490 2:10874024-10874046 GACGGGTGTTTCCAGATTATAGG + Intergenic
926250170 2:11151134-11151156 GAGGGGGGCTTCCAGGTCATAGG - Intergenic
926348363 2:11970660-11970682 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
926919660 2:17927854-17927876 GTGGGGGGCTTCCAGGCCATAGG - Intronic
927505830 2:23614136-23614158 GAAGGGGGTTTCCAAGTCATAGG - Intronic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
928347419 2:30513801-30513823 GGAGGGGGCTTCCAGGTCATAGG - Intronic
928604813 2:32935962-32935984 GCAGGGGGTTTTCAGGTCATAGG - Intergenic
929490824 2:42394653-42394675 GGGAGGGGCTTCCAGGTCATAGG - Intronic
929535666 2:42782765-42782787 GAAGGGGGCTTCCAGGTCACAGG - Intronic
930488368 2:52037403-52037425 GTGGGGGGTTTCCACGTCATAGG - Intergenic
930494691 2:52126503-52126525 GGGAGGGGCTTCCAGGTCATAGG - Intergenic
930495116 2:52131589-52131611 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
930510574 2:52338887-52338909 GGAGGGGGTTTCCAGGTCATAGG + Intergenic
931068917 2:58622233-58622255 GTGGGGTGCTTCCAGTTCATAGG + Intergenic
931237676 2:60425291-60425313 GAAGGGGGTTTCCAGGTCATAGG - Intergenic
931446410 2:62330877-62330899 GTGGGGGACTTCCAGGTCATAGG + Intergenic
932805254 2:74777746-74777768 GGAGGGGGGTTCCAGTTCACTGG - Intergenic
933620281 2:84531119-84531141 GGAGGGGGCTTCCAGGTCATAGG + Intronic
933718898 2:85384050-85384072 GGAGGGGGTTTCCAGGTCATAGG + Intronic
935807343 2:106762104-106762126 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
937850066 2:126624017-126624039 GTGGGGGGCTTCCAGTTTATAGG + Intergenic
937891360 2:126941435-126941457 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
938142088 2:128803006-128803028 GTGGGGGGCTTCCAGATCATAGG + Intergenic
940707975 2:157127298-157127320 GTGGGGGGTGTCCAGATTATTGG - Intergenic
940987827 2:160065959-160065981 GAGCGGGGCTTCCAGGTCATAGG + Intergenic
940988337 2:160072366-160072388 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
942172889 2:173304721-173304743 GAGGGAGGCTTCCAGGTCACAGG + Intergenic
943256453 2:185599483-185599505 GGTGGGGGCTTCCAGGTCATAGG + Intergenic
943438004 2:187891386-187891408 GGAGGGGGTTTCCAGGTCACAGG + Intergenic
943557717 2:189426417-189426439 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
944893854 2:204144339-204144361 GAGGGGGGCTTCCAGGTCACAGG - Intergenic
944939631 2:204609548-204609570 GAGTGGGGGTTACAGGTCATGGG + Intronic
945436168 2:209820485-209820507 GAGGGAGCTTTCCAATTCAAAGG + Exonic
946505705 2:220298567-220298589 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
947452535 2:230221717-230221739 GAAGGGGCTTTCCAGGTGATGGG - Intronic
947618021 2:231570708-231570730 CTGGGGGGCTTCCAGGTCATAGG + Intergenic
947814815 2:233029486-233029508 GAAGGCAGTTTCCAGATCATAGG - Intergenic
948063019 2:235055929-235055951 GACTGGGGTTGCCAATTCATGGG - Intergenic
948152643 2:235756432-235756454 AAGAGGGGTTTCCCTTTCATAGG + Intronic
948882604 2:240867988-240868010 TTGGGGGGCTTCCAGGTCATAGG + Intergenic
949060784 2:241955922-241955944 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1168825437 20:810185-810207 GGAGGGGTTTTCCAGGTCATAGG - Intergenic
1169729435 20:8770679-8770701 GGAGGGGGTTTCCAGGTCATAGG + Intronic
1170599273 20:17828612-17828634 GAGGGGTGTTACCAGGTGATAGG + Intergenic
1173377388 20:42498819-42498841 GTGTGGGGCTTCCAGGTCATAGG - Intronic
1173525963 20:43732817-43732839 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1174095421 20:48085370-48085392 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1174159050 20:48537389-48537411 GGGTGGGGCTTCCAGGTCATAGG + Intergenic
1174543193 20:51305782-51305804 GAGGGGAGCTTCCAGGTCATAGG + Intergenic
1174544038 20:51311804-51311826 GAGGCGGGGTTCCAGGTCATAGG + Intergenic
1174913921 20:54635563-54635585 AATGGGGGCTTCCAGGTCATAGG - Intronic
1175505095 20:59477102-59477124 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1176068640 20:63214619-63214641 GGAGGGGGCTTCCAGGTCATAGG + Intronic
1176291530 21:5047912-5047934 GAGCAGGGTTTACAGGTCATAGG - Intergenic
1176421863 21:6522581-6522603 GGAGGGGGCTTCCAGGTCATGGG + Intergenic
1177003192 21:15638898-15638920 GCAGGGGGCTTCCAGGTCATAGG - Intergenic
1177013826 21:15759522-15759544 CAGGGTGGCTTCCAGGTCATCGG + Intronic
1177262787 21:18751341-18751363 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1177887425 21:26763068-26763090 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1178306211 21:31492541-31492563 GCGAGGGGCTTCCAGGTCATAGG - Intronic
1178436298 21:32561771-32561793 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1178512453 21:33216839-33216861 GAAGGGGGCTTCCAGGTCATAGG + Intergenic
1178516778 21:33254702-33254724 TGGGGGGGCTTCCAGGTCATAGG - Intronic
1179596302 21:42445198-42445220 GAGGGTGATGTCCAGTCCATGGG + Intronic
1179620155 21:42609071-42609093 GGTGGGGGCTTCCAGGTCATAGG - Intergenic
1179697353 21:43130897-43130919 GGAGGGGGCTTCCAGGTCATGGG + Intergenic
1179865725 21:44215729-44215751 GAGCAGGGTTTACAGGTCATAGG + Intergenic
1181336335 22:22133250-22133272 GGTGGGTGCTTCCAGTTCATAGG + Intergenic
1182453913 22:30437601-30437623 GGTGGGGGCTTCCAGGTCATGGG + Intergenic
1183007704 22:34917020-34917042 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1183114043 22:35675884-35675906 GGTGGGTGTTTCCAGTTTATAGG - Intergenic
1184171738 22:42764222-42764244 GATGGGGTTTTTCAGCTCATGGG - Intergenic
1184724324 22:46334823-46334845 GGGTGGGGCTTCCAGGTCATAGG + Intronic
1184890797 22:47377944-47377966 GGGAGGGGCTTCCAGGTCATAGG - Intergenic
1185076369 22:48685110-48685132 GGTGGGGGCTTCCAGGTCATAGG + Intronic
949163882 3:913776-913798 GGGAGGGGCTTCCAGGTCATAGG - Intergenic
949699189 3:6736300-6736322 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
950504379 3:13385204-13385226 GAGTGGTGTCTCCAGTTGATGGG - Intronic
950599897 3:14024546-14024568 GGAGGGGGCTTCCAGGTCATAGG + Intronic
950600741 3:14033196-14033218 GAAGGGGCCTTCCAGGTCATAGG + Intronic
950919869 3:16683643-16683665 GAAGGGGGCTTCCACGTCATAGG - Intergenic
951000643 3:17555422-17555444 AAAGGGGGCTTCCAGGTCATAGG + Intronic
951295166 3:20924714-20924736 GAAGGGTGCTTCCAGGTCATAGG + Intergenic
951842132 3:27045763-27045785 GTGGGGGGCTTCCATGTCATGGG + Intergenic
952420525 3:33126847-33126869 GGAGGGGGTTTCCAGGTCATAGG + Intronic
952491603 3:33879284-33879306 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
952601525 3:35089072-35089094 GAGTGTGGTTTCCAGGTCAAAGG - Intergenic
952706405 3:36381638-36381660 GAAAGGGGTTGCCAGTTTATAGG + Intronic
953178096 3:40570272-40570294 GTAGGGGGTTTCCAGGTCATAGG + Intronic
953378171 3:42446212-42446234 GCAGGGGGCTTCCAGGTCATAGG + Intergenic
953683473 3:45057870-45057892 AAGGGGGGTTTCCAGGTCACAGG + Intergenic
955424802 3:58777229-58777251 GGAGGGGGCTTCCAGGTCATAGG - Intronic
956296730 3:67722920-67722942 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
956686953 3:71838622-71838644 GGGAGGGGCTTCCAGGTCATAGG - Intergenic
956706966 3:72007489-72007511 GGTGGGGGCTTCCAGGTCATAGG - Intergenic
957063118 3:75498430-75498452 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
957354874 3:79068831-79068853 GAGGAAGATTTCCATTTCATTGG - Intronic
957539676 3:81551573-81551595 GGAGGGGGCTTCCAGGTCATAGG - Intronic
958954371 3:100451360-100451382 GCAGGGGGCTTCCAGGTCATGGG + Intronic
959690249 3:109190495-109190517 GGGAGGGGTTTCCAGGTCATAGG - Intergenic
961795156 3:129403809-129403831 GAGGTGGGCTTGCAGCTCATAGG - Intronic
964219592 3:154328122-154328144 GAGGGAGTTTTCCAGGTCACAGG - Intergenic
964486513 3:157190816-157190838 GGAGGGGATTTCCAGGTCATAGG - Intergenic
964862234 3:161215657-161215679 GGCGGGGGGTTCCAGGTCATAGG - Intronic
965649012 3:170913792-170913814 GGGTGGGGCTTCCAGGTCATAGG + Intergenic
966227100 3:177609681-177609703 GAGTGGAGTTTACAGGTCATAGG + Intergenic
966755935 3:183371397-183371419 GAGGGGGGTTTCCAGTTCATAGG + Intronic
967124186 3:186409609-186409631 TAGGGGGGTGTCCATTTAATGGG + Intergenic
967229365 3:187323019-187323041 AATGGGGGTTTCTAGGTCATAGG + Intergenic
968295629 3:197574539-197574561 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
968363165 3:198163162-198163184 GGGGGGGGCTTCCAGGTTATAGG + Intergenic
968379223 4:74701-74723 GGAGGGGGCTTCCAGGTCATAGG + Intronic
968491323 4:892074-892096 GTGGAGGGTTTGCAGTTCCTTGG - Intronic
969007006 4:4028443-4028465 GGAGGGGGCTTCCAGTTCATAGG - Intergenic
969049306 4:4361371-4361393 GGAGGGGGTTTCCAGGTCCTAGG - Intronic
969579046 4:8053240-8053262 GGAGGGGGCTTCCAGGTCATGGG - Intronic
969805963 4:9609014-9609036 GGGAGGGGCTTCCAGGTCATAGG + Intergenic
970853291 4:20626949-20626971 AAGGGGGGCTTCCAGGTCATAGG + Intergenic
971006770 4:22382966-22382988 GGAGGGGGCTTCCAGATCATAGG + Intronic
971019813 4:22523208-22523230 GGAGGGGGTTTCCAGGTCACAGG + Intergenic
972055133 4:34792486-34792508 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
972187995 4:36555512-36555534 GGAGGGGGTTTCCAGGTCATAGG - Intergenic
973246164 4:48013513-48013535 GACGGGGCTTTCCAGGTCATAGG + Intronic
973938814 4:55881646-55881668 GGAGGGGGCTTCCAGATCATAGG + Intronic
974030070 4:56768793-56768815 GAGGGCAGTTTCCAGCACATGGG + Intergenic
974633848 4:64532941-64532963 TTGGGGGGCTTCCAGGTCATAGG + Intergenic
974980645 4:68953355-68953377 GAGTGGGGCTTCCAGGTCATAGG - Intergenic
976261891 4:83153498-83153520 GAGGGAAGTTCCAAGTTCATTGG - Intergenic
977352055 4:95901039-95901061 GATGGGTGCTTCCAGGTCATAGG + Intergenic
977354894 4:95933209-95933231 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
977411500 4:96671983-96672005 GGAGGGGCTTTCCAGGTCATAGG + Intergenic
978356828 4:107884702-107884724 GGAGGGGGCTTCCAGGTCATAGG - Intronic
978598677 4:110405634-110405656 GTGGGGGCCTTCCAGGTCATAGG - Intronic
979001214 4:115222390-115222412 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
980220292 4:129904107-129904129 GAGGAGGGTTTCCAGAATATGGG + Intergenic
980683801 4:136199867-136199889 GAGGGGGGTCTCAAGTAGATGGG + Intergenic
981564285 4:146081743-146081765 GAGGGGGCTTTCAAGTTTTTTGG + Intergenic
982197294 4:152929173-152929195 CAGAGGGGCTTCCAGGTCATAGG + Intergenic
983035877 4:162865105-162865127 GAGTGTGGTTTCCAGGTCAATGG - Intergenic
983044974 4:162975620-162975642 GAAGGAGGCTTCCAGATCATAGG + Intergenic
983822771 4:172216928-172216950 GAGGGGGGCTTCCAGGCTATAGG + Intronic
984156074 4:176197486-176197508 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
984170994 4:176359017-176359039 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
984964853 4:185130759-185130781 GAGAGCGGCTTCCAGGTCATAGG + Intergenic
985080932 4:186263197-186263219 GAAGGGGGCTTCCAGGTCATAGG - Intergenic
985659077 5:1146830-1146852 AAGTGGGGCTTCCAGGTCATAGG - Intergenic
986220206 5:5762241-5762263 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
986274077 5:6258258-6258280 GAGGGGAGGTTCCTCTTCATTGG - Intergenic
986922893 5:12709231-12709253 GAGGATGGCTTCCAGGTCATAGG + Intergenic
987474082 5:18369320-18369342 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
988326185 5:29771096-29771118 GAGTGGGTTTTCCAGATAATTGG + Intergenic
988633169 5:32952749-32952771 GAGGGGGGCTTCCAGGCTATAGG - Intergenic
988769979 5:34422630-34422652 GAGAGGGGCTTCCAGATCACAGG - Intergenic
989183397 5:38600152-38600174 GCAGGGGGTTTCCAGGTCATAGG - Intronic
990123111 5:52480437-52480459 GTGGGAGGCTTACAGTTCATAGG - Intergenic
990705990 5:58530469-58530491 GAGGGGGCCTTCCAGGTCATAGG + Intergenic
991773052 5:70057795-70057817 TAGGGAGGTTTCTAGGTCATAGG - Intronic
991852345 5:70933219-70933241 TAGGGAGGTTTCTAGGTCATAGG - Intronic
992291657 5:75285680-75285702 GAAGGGGGCTACCAGGTCATAGG - Intergenic
992292978 5:75299390-75299412 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
992446615 5:76839847-76839869 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
994044792 5:95295711-95295733 AGGGGGGTTTTCCAGGTCATAGG - Intergenic
994776263 5:104038697-104038719 GAAGGGGGCTTCCAGGTCACAGG - Intergenic
995593446 5:113723810-113723832 GGGAGGGGTTTCCAGGTCATAGG + Intergenic
996128518 5:119753317-119753339 GAGTGTGGTTTCCAGGTCAATGG - Intergenic
998032580 5:138884184-138884206 GTGGGGGGCTTCCAGGTCATAGG + Intronic
998261846 5:140637832-140637854 GTGGGGGGCTTCCAGCTTATAGG - Intergenic
998487035 5:142511919-142511941 GAGGGGGGTTTCTTGTTCCAGGG - Intergenic
998571572 5:143263943-143263965 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
998905550 5:146900798-146900820 CTGGGGGGTGTCCAGTGCATGGG - Intronic
999359438 5:150970523-150970545 GGAGGGGGTTTCCAGGTCATAGG - Intergenic
999545676 5:152626000-152626022 GAAGGGGGCTTCCAGGTCATAGG - Intergenic
1000071094 5:157741825-157741847 GACGGGGGTTTTCACTACATTGG + Intergenic
1000365077 5:160483122-160483144 GGTGGGGGCTTCCAGATCATAGG - Intergenic
1001706703 5:173746355-173746377 GGGGGTGGTTTCCAGGTCATAGG - Intergenic
1001856748 5:175018413-175018435 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1002031261 5:176432397-176432419 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1002703400 5:181143193-181143215 GGAGGGGGCTTCCAGCTCATGGG - Intergenic
1003204133 6:3991683-3991705 GAGGGGCAGTTCCAGGTCATAGG - Intergenic
1003884674 6:10510750-10510772 GGGGTGAGTTTCCAGTTCACTGG + Intronic
1004320613 6:14628801-14628823 GAGGGGGCTTTCCAGCTCTTTGG - Intergenic
1004745717 6:18507229-18507251 AAATGGGCTTTCCAGTTCATTGG + Intergenic
1004901415 6:20197615-20197637 GGAGGGGGCTTCCAGGTCATAGG - Intronic
1005322593 6:24669317-24669339 GAAGGGGGCTTCCAGGTCACGGG + Intronic
1005370670 6:25129134-25129156 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1005371266 6:25136277-25136299 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1005621620 6:27625680-27625702 GGAGGGGGTTTCCAGGTCATAGG + Intergenic
1006838038 6:37011052-37011074 GAGGGGGGTGTCCTGGTCACTGG - Intronic
1007414225 6:41682792-41682814 CAGAGGGGTTTCCAGGGCATGGG + Intergenic
1008172376 6:48224306-48224328 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1008479108 6:51966298-51966320 GAGGGGGACTTCCAGGTCACAGG + Intronic
1008775410 6:55032018-55032040 GGGGGTGGTTTCCAGGTCAATGG + Intergenic
1009379776 6:63012569-63012591 GAAAGGGGCTTCCAGGTCATAGG + Intergenic
1010606984 6:77902762-77902784 GAGGGGGCTTTCCATGTCATAGG - Intronic
1010849962 6:80761728-80761750 GATGAAGATTTCCAGTTCATTGG - Intergenic
1010970851 6:82261654-82261676 GGAGGGGGCTTCCAGTTCATAGG - Intergenic
1011857408 6:91711668-91711690 GTGGGGGCTGCCCAGTTCATTGG + Intergenic
1012136691 6:95566317-95566339 GAAGGCAGTTTCCAGTTCCTAGG - Intergenic
1012205772 6:96458645-96458667 GTGGGTGGTTTCCAGGTCATAGG + Intergenic
1012825236 6:104139301-104139323 GGAGGGGGTTTCCAGGTCACAGG - Intergenic
1013888144 6:114996240-114996262 GAGAGGGACTTCCAGGTCATAGG + Intergenic
1014110167 6:117612058-117612080 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1014252515 6:119129099-119129121 GAGAGGGGCTTCCAGGTTATAGG - Intronic
1014848810 6:126314211-126314233 GTGGGGAGCTTCCAGGTCATAGG - Intergenic
1015775804 6:136812901-136812923 GGGGGTGGCTTCCAGGTCATAGG - Intergenic
1016295088 6:142565256-142565278 GTGGGGAGTTTCCAGTTTATAGG + Intergenic
1016494193 6:144641277-144641299 GACGGGTGCTTCCAGGTCATAGG + Intronic
1017367680 6:153664078-153664100 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1018138428 6:160802264-160802286 AGAGGGGGTTTCCAGGTCATAGG - Intergenic
1018179930 6:161214136-161214158 GAGAGGGGCTTCCAGGTCACAGG - Intronic
1018561331 6:165103429-165103451 GGGGGGGGGTTCCAGCTCACAGG + Intergenic
1018780278 6:167057525-167057547 GTGGGAGGCTTCCAGGTCATAGG + Intergenic
1019014550 6:168870571-168870593 GGTGGGGGCTTCCAGGTCATAGG - Intergenic
1019151489 6:170009049-170009071 AAGGGAGGTTTCCAGGTTATAGG + Intergenic
1019252515 7:25549-25571 GGGGGGGGCTTCCAGGTTATAGG - Intergenic
1019728104 7:2614098-2614120 GAAGGGGGTTTCTGGTCCATCGG - Exonic
1020756930 7:12214453-12214475 CTGGGGGGTGTCCAGGTCATAGG - Intronic
1020896424 7:13945761-13945783 CAGGCGGTTTTCCAGTTCATTGG + Intronic
1020974518 7:14988397-14988419 GGTGGGGGCTTCCAGGTCATAGG + Intergenic
1021096660 7:16542568-16542590 GAAGGAGGCTTCCAGGTCATGGG + Intronic
1021986842 7:26105590-26105612 GAGGGAGGATTGCAATTCATGGG - Intergenic
1022440017 7:30425615-30425637 GAGGATGCTTTCCTGTTCATGGG - Exonic
1022458786 7:30584634-30584656 GACCTGGGTTTCCAGGTCATAGG - Intergenic
1022616569 7:31937003-31937025 GAGGGGTGCTTCCAGGTCATAGG + Intronic
1022679206 7:32528151-32528173 GGGTGGTGTTTCCAGGTCATAGG - Intronic
1024317958 7:48038872-48038894 GGGGGGTGGTTCCAGGTCATAGG + Intronic
1024388391 7:48779685-48779707 GAAGGGGGCATCCAGGTCATAGG + Intergenic
1025112784 7:56233759-56233781 GGAGGGGGCTTCCAGGTCATGGG - Intergenic
1026142545 7:67718612-67718634 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1026303605 7:69120699-69120721 GGAGGGGGCTTCCAGGTCATGGG + Intergenic
1026493831 7:70885870-70885892 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1026509649 7:71017467-71017489 GGTGGGGGCTTCCAGGTCATAGG - Intergenic
1026537747 7:71254116-71254138 GAGGAGAGCTTCCAGGTCATAGG + Intronic
1026583202 7:71634831-71634853 GCAGGGGGTTTCCAGCTTATAGG + Intronic
1026606464 7:71820262-71820284 GTGGGGAGCTTCCAGGTCATAGG - Intronic
1026610865 7:71858729-71858751 GGAGGGGGCTTCCAGGTCATAGG - Intronic
1027733446 7:81903976-81903998 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1028035695 7:85979028-85979050 CAGGCTGGTTTCCAGTTCCTGGG - Intergenic
1029500791 7:100928208-100928230 CAGGGGGACTTCCAGATCATAGG + Intergenic
1030877416 7:114832189-114832211 GGGAGGGGCTTCCAGGTCATAGG + Intergenic
1031727399 7:125258145-125258167 GGAGGGGGCTTCCAGGTCATGGG + Intergenic
1032144520 7:129366987-129367009 GGAGGGGGCTTCCAGGTCATGGG + Intronic
1032406784 7:131661819-131661841 GGAGGGGGCTTCCAGGTCATGGG + Intergenic
1032801311 7:135319339-135319361 GGGGGGGGGTTCCAGGTCATAGG - Intergenic
1033462105 7:141556124-141556146 GAAGGGAGCTTCCAGGTCATAGG + Intronic
1034053593 7:148010624-148010646 GAGGTGGCTTTACAGTTCAGTGG - Intronic
1034060084 7:148079314-148079336 AAGGGGGCCTTCCAGGTCATAGG + Intronic
1034062245 7:148103027-148103049 GGAGGGGGCTTCCAGGTCATAGG + Intronic
1034237113 7:149580548-149580570 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1034240194 7:149604353-149604375 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1034334665 7:150313321-150313343 GTGGGGGTGTTCCAGGTCATAGG + Intronic
1034736009 7:153430168-153430190 GAGGGGGGCTTCCAGGTCCCAGG - Intergenic
1035687061 8:1532015-1532037 CAGAGGGGGTTCCAGGTCATAGG + Intronic
1035811009 8:2491102-2491124 GATGGGGGGCTCCAGGTCATAGG + Intergenic
1035832618 8:2714020-2714042 GGACGGGGTTTCCAGGTCATAGG + Intergenic
1035919716 8:3663673-3663695 AGAAGGGGTTTCCAGTTCATAGG - Intronic
1035950393 8:4013446-4013468 CAGGGGGGTTTCCAGGACATGGG + Intronic
1036145826 8:6253800-6253822 GGAGGGGGCTTCCAGGTCATGGG - Intergenic
1036827638 8:11990551-11990573 GAGGGGAGCTTCCAGGTCATAGG - Intergenic
1037396450 8:18448959-18448981 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1037647256 8:20803762-20803784 GGAGGGGGTTTCCAGGTCACAGG - Intergenic
1037965804 8:23133288-23133310 GGAGGGGGCTTCCAGCTCATAGG - Intergenic
1038293961 8:26274021-26274043 GAAGGGGGCTTCCGGATCATAGG - Intergenic
1038641211 8:29330333-29330355 GATGGGGGCATCCAGGTCATAGG + Intergenic
1038727000 8:30090553-30090575 GGAGGGGGTGTCCAGGTCATAGG - Intergenic
1039501339 8:38019996-38020018 GGGGGGGCCTTCCAGGTCATAGG + Intergenic
1040020864 8:42739675-42739697 GGAGGGGGTTTCCAAGTCATAGG + Intergenic
1040922136 8:52633045-52633067 GAAGAGGGCTTCCAGGTCATAGG - Intronic
1040997798 8:53419387-53419409 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1041192492 8:55367874-55367896 GAAGGGGGGTACCAGTTCACTGG - Intronic
1042820296 8:72923032-72923054 GGGGGGAGCTTCCAGGTCATAGG + Intronic
1043396966 8:79847299-79847321 GAGGGGGTTTTCTAGATAATAGG - Intergenic
1043413085 8:80020082-80020104 GAGGGTGGCTTCCAGGTCATAGG + Intronic
1043561106 8:81494329-81494351 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1044007172 8:86952090-86952112 GGAGGGGGCTTCCAGGTCATAGG - Intronic
1044222418 8:89684950-89684972 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1044659401 8:94580267-94580289 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1045099854 8:98833217-98833239 GGGGGAGGGTTCCAGGTCATAGG + Intronic
1045290778 8:100830779-100830801 GCAGGGGATTTCCAGGTCATAGG + Intergenic
1046919977 8:119717677-119717699 GAAAGGGGCTTCCAGGTCATGGG - Intergenic
1047880219 8:129184698-129184720 GAGTGGAGTTTCTAGGTCATAGG - Intergenic
1048388492 8:133936964-133936986 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1048415645 8:134225197-134225219 GAGGGGGGTGTACATTACATGGG - Intergenic
1049103221 8:140594203-140594225 GAGGGGGCTTGCCAGTTAAGGGG + Intronic
1050545594 9:6706178-6706200 GGAGTGGGTTTCCAGGTCATAGG + Intergenic
1050796914 9:9557747-9557769 GAAGGGGGCTTCCAGATCATAGG - Intronic
1050990457 9:12144770-12144792 GGAGGGGGATTCCAGGTCATAGG - Intergenic
1052095003 9:24373355-24373377 GAAGGGGGCTTCCAGGTCATAGG + Intergenic
1052183556 9:25562103-25562125 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1055019644 9:71656115-71656137 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1055161998 9:73141859-73141881 GAGGGGGGCTTCCAGGTCACAGG - Intergenic
1055449507 9:76418148-76418170 GAGGAGGGGTTCCAGGTTATAGG + Intergenic
1055451876 9:76438280-76438302 GGGGGTGGCTTCCAGGTCATAGG + Intronic
1055568934 9:77596855-77596877 GGGAGGGGCTTCCAGGTCATAGG - Intronic
1055662921 9:78524215-78524237 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1055832757 9:80401569-80401591 AAGGTGGGCTTCCAGGTCATAGG - Intergenic
1056058200 9:82851795-82851817 CAGGGGAGTTTCCAGGTCATAGG - Intergenic
1056891104 9:90493684-90493706 GAGAAGGGTTTCCAGATCATAGG - Intergenic
1057467082 9:95323931-95323953 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1057550469 9:96048291-96048313 GAGGGGGGTTTCCAGGGCTTAGG - Intergenic
1058245230 9:102615155-102615177 GAGGGGGGCTTCCAGGACACAGG - Intergenic
1058370269 9:104258536-104258558 GAGGGGGGCTTCCAGGTCACAGG - Intergenic
1058950659 9:109900969-109900991 GAAGGGAGTTTCAAGCTCATAGG + Intronic
1058996871 9:110307762-110307784 GGAGGGGGCTTCCAGGTCATAGG - Intronic
1058997468 9:110314194-110314216 GGAGGGGGCTTCCAGGTCATAGG - Intronic
1059730237 9:117049992-117050014 GTGGGGGGTTTCTGATTCATAGG + Intronic
1060057382 9:120426420-120426442 GTGGCGGGCTTCCAGGTCATTGG + Intronic
1061031223 9:128084545-128084567 GGCGGGGGCTTCCAGATCATAGG - Intronic
1061239719 9:129362559-129362581 GAGAGGGGCCTCCAGGTCATGGG + Intergenic
1062259236 9:135651468-135651490 GAGGGGGGCTTCCAGGTCATAGG + Intergenic
1062747852 9:138226822-138226844 GGGGGGGGCTTCCAGGTTATAGG + Intergenic
1185491039 X:517175-517197 GAAGAGGGTTTCCAGATCACAGG + Intergenic
1185715116 X:2335388-2335410 GGAGGGGGCTTCCAGGTCATAGG + Intronic
1185788742 X:2912348-2912370 AAGGGGGGCTTCCAGGTCAAAGG - Intronic
1185934574 X:4241280-4241302 GAAGGGGGCTTCCAGGTCACAGG - Intergenic
1186046389 X:5541360-5541382 GAAGGGGGCTTCCAGGTCATAGG + Intergenic
1186175334 X:6920634-6920656 GAGGGGGGCTTCCAAGTCACAGG - Intergenic
1186328496 X:8506910-8506932 TTGGGGGGCTTCCAGGTCATAGG + Intergenic
1186811970 X:13199183-13199205 GCTGGGGGCTTCCAGGTCATAGG - Intergenic
1186830008 X:13380752-13380774 GAGTCGGGCTTCCAGGTCATAGG + Intergenic
1187139850 X:16583201-16583223 GGAGGGGGTTTCCAGGTCATAGG - Intergenic
1188569178 X:31561384-31561406 AAGGGAGGTATCCTGTTCATTGG + Intronic
1188751271 X:33908397-33908419 GTTGGGGGCTTCCAGGTCATAGG - Intergenic
1188833888 X:34932985-34933007 GAGTGGGGCTTCCAGTTCTGTGG - Intergenic
1189493411 X:41487787-41487809 GAAGGGGCCTTCCAGGTCATAGG - Intergenic
1190327533 X:49215937-49215959 GAGTGGGGATTCAAGTTGATGGG - Intronic
1190426618 X:50339301-50339323 GGAGGGGGCTTCCAGGTCATAGG + Intronic
1191006171 X:55713631-55713653 GAGGGGGGCTTCCAGCTTATAGG + Intergenic
1192904254 X:75533550-75533572 GAGTGGGGTTTCTGGTTCCTTGG + Intergenic
1193264346 X:79450927-79450949 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1193283896 X:79688992-79689014 CAGGGGGGTTTCCAGGTTATAGG + Intergenic
1193319546 X:80105623-80105645 GAAGGGGGCTTCCAGGTCATAGG - Intergenic
1193850930 X:86536654-86536676 GTGGGGGAATTCCAGGTCATTGG - Intronic
1194492510 X:94569175-94569197 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1194985963 X:100490055-100490077 GAGGAGGGGTTCCAGGTCACAGG + Intergenic
1195291986 X:103438403-103438425 GATGTGGGCTTCCAGATCATAGG - Intergenic
1195327272 X:103767838-103767860 GAAGGGGGCTTCTAGGTCATAGG + Intergenic
1195534043 X:105990607-105990629 GTAGGGGGCTTCCAGGTCATAGG - Intergenic
1196172974 X:112610212-112610234 GAATGGAGTTTCCAGCTCATGGG - Intergenic
1196223034 X:113134584-113134606 GTGGGGGGCTTACAGGTCATAGG + Intergenic
1196287369 X:113898096-113898118 GCGGGGGGCTTCCAGGTTATAGG + Intergenic
1196382795 X:115110221-115110243 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1197296054 X:124720417-124720439 GTGGGGAGCTTCCAGGTCATAGG - Intronic
1197347117 X:125337346-125337368 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1198559915 X:137838272-137838294 GAGTGTGGTTCCCAGTCCATTGG + Intergenic
1198751333 X:139939048-139939070 GGAGGGGGCTTCCAGGTCATAGG - Intronic
1199150885 X:144485601-144485623 GGAGGGGGCTTCCAGGTCATAGG - Intergenic
1199166160 X:144678213-144678235 GGAGGGGGTTTCCAGGTCATAGG - Intergenic
1199186428 X:144920844-144920866 GAAGGGGGATTCCAGGTTATAGG + Intergenic
1199232951 X:145460644-145460666 AAGTGGGGCTTCCAGTTCATAGG - Intergenic
1199332279 X:146576366-146576388 GCAGGGGGCTTCCAGGTCATAGG + Intergenic
1199398401 X:147367505-147367527 GGGGAGGGGTTCCAGGTCATAGG + Intergenic
1199746827 X:150776963-150776985 GTGGGGTGCTTCCAGGTCATAGG + Intronic
1199887911 X:152040609-152040631 GGAGGGGGTTTCCAGCTCATAGG + Intergenic
1199984436 X:152940436-152940458 GGGGTGGGGTTCCAGGTCATAGG + Intronic
1200159193 X:153996327-153996349 GGAGGGGGCTTCCAGGTCATGGG - Intergenic
1200767908 Y:7096089-7096111 GGAGGGGGCTTCCAGGTCATAGG + Intergenic
1201148333 Y:11079313-11079335 GGGGAGGGTTTCCAGGTCATAGG - Intergenic
1201433809 Y:13934011-13934033 GTGGGGGGCTTCCAGGGCATAGG - Intergenic
1201693731 Y:16799692-16799714 GGAGGGGGCTTCCAGTTCATAGG - Intergenic
1201738540 Y:17298441-17298463 AAGTGGGGCTTCCAGGTCATAGG - Intergenic
1202173197 Y:22072891-22072913 CAGGGTGGTCTCCAATTCATGGG - Intronic
1202218163 Y:22513480-22513502 CAGGGTGGTCTCCAATTCATGGG + Intronic
1202325022 Y:23682575-23682597 CAGGGTGGTCTCCAATTCATGGG - Intergenic
1202545749 Y:25987479-25987501 CAGGGTGGTCTCCAATTCATGGG + Intergenic