ID: 966757457

View in Genome Browser
Species Human (GRCh38)
Location 3:183384762-183384784
Sequence CCTGCTGCCCAGACAGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 307}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966757457_966757462 -2 Left 966757457 3:183384762-183384784 CCTGGTTCTGTCTGGGCAGCAGG 0: 1
1: 0
2: 3
3: 29
4: 307
Right 966757462 3:183384783-183384805 GGCAAGGTGAACCCCTAGGGTGG 0: 1
1: 67
2: 135
3: 247
4: 298
966757457_966757467 25 Left 966757457 3:183384762-183384784 CCTGGTTCTGTCTGGGCAGCAGG 0: 1
1: 0
2: 3
3: 29
4: 307
Right 966757467 3:183384810-183384832 AGTTGGAGCTCTATACTCTTTGG 0: 1
1: 0
2: 0
3: 8
4: 106
966757457_966757463 8 Left 966757457 3:183384762-183384784 CCTGGTTCTGTCTGGGCAGCAGG 0: 1
1: 0
2: 3
3: 29
4: 307
Right 966757463 3:183384793-183384815 ACCCCTAGGGTGGTTACAGTTGG 0: 1
1: 0
2: 2
3: 23
4: 120
966757457_966757461 -5 Left 966757457 3:183384762-183384784 CCTGGTTCTGTCTGGGCAGCAGG 0: 1
1: 0
2: 3
3: 29
4: 307
Right 966757461 3:183384780-183384802 GCAGGCAAGGTGAACCCCTAGGG 0: 1
1: 39
2: 108
3: 276
4: 483
966757457_966757460 -6 Left 966757457 3:183384762-183384784 CCTGGTTCTGTCTGGGCAGCAGG 0: 1
1: 0
2: 3
3: 29
4: 307
Right 966757460 3:183384779-183384801 AGCAGGCAAGGTGAACCCCTAGG 0: 40
1: 114
2: 253
3: 381
4: 601

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966757457 Original CRISPR CCTGCTGCCCAGACAGAACC AGG (reversed) Intronic
900093372 1:930139-930161 CCTCCTGCCCCACCAGAACCGGG + Exonic
900546735 1:3233595-3233617 CCTGCTGGGCAGAGAGGACCAGG - Intronic
900820014 1:4879397-4879419 CCTGTTGCCCCGAGAGTACCGGG - Intergenic
900931753 1:5742258-5742280 CCTGGGGCCCAAACAGCACCGGG - Intergenic
900952837 1:5867620-5867642 CGTGCTGCTCTGACAGCACCAGG + Intronic
901903411 1:12387107-12387129 CCTGCTGCCCACACAGGGCTAGG + Intronic
902580034 1:17402404-17402426 CCTGCTGCCCACAGAGCCCCAGG - Intergenic
903788528 1:25876525-25876547 CCTGTGGCCCAGAGAGAACAAGG - Intergenic
904684719 1:32251706-32251728 CCTGAGGCCCAGAGAGAACAAGG + Intronic
907275214 1:53313226-53313248 CCAGGTGCCCTGCCAGAACCTGG - Intronic
907834788 1:58098514-58098536 CCTGTTGGCCACACTGAACCAGG + Intronic
910476046 1:87608639-87608661 ACGGCTGCCCAGACAAAAACTGG + Intergenic
914690525 1:150022011-150022033 CCTGCTTCCCAGCCTGAGCCTGG + Intergenic
916057051 1:161074931-161074953 CCTGCTGCCCAGCCTGACCTGGG + Intronic
916674513 1:167054459-167054481 CCTGCTGCCCTGCAGGAACCGGG - Exonic
916808449 1:168283131-168283153 CGTGTTGCCCAGACTGATCCCGG - Intronic
918634199 1:186755508-186755530 CCTGCTGCCCGGACCTAAGCTGG + Intergenic
919501676 1:198345216-198345238 CCTGCTGCCCAGAGACCACTGGG + Intergenic
920195567 1:204223907-204223929 ACTACTGTGCAGACAGAACCAGG + Intronic
921670296 1:217917455-217917477 CCTCCTGCTCAGACAGGCCCTGG + Intergenic
922730289 1:227945860-227945882 CCAGCAGCCCAGATGGAACCTGG + Intronic
1063367134 10:5498474-5498496 CCAGCAGCTCAGGCAGAACCTGG + Intergenic
1064778582 10:18807848-18807870 TCTGTTGCACAGACAGAACTGGG + Intergenic
1064872379 10:19952843-19952865 CCTTCTGGCCAGACAAAAACAGG - Intronic
1066252089 10:33644185-33644207 CCTGCTGCACATGCACAACCTGG - Intergenic
1066522832 10:36241968-36241990 CCTCCTCCCAAGACTGAACCAGG + Intergenic
1067143031 10:43672056-43672078 CTTGCTGGCCAAACAAAACCAGG - Intergenic
1069526850 10:69180197-69180219 CCTGCTGTCCAGAAAGACCCAGG - Intergenic
1070549497 10:77480060-77480082 CCTGCAGCCAAGACAGAAGCTGG + Intronic
1071275863 10:84054470-84054492 CCACCTGCCCAAACAGAAACAGG - Intergenic
1072619957 10:97073360-97073382 CATTCTGCCCAGACACATCCTGG - Intronic
1073140024 10:101241090-101241112 CCTTCTGCACAGGCAGAACCTGG - Intergenic
1073232798 10:101986708-101986730 CCTGCTGCCCAGCTGGAAGCAGG + Intronic
1073290952 10:102413062-102413084 CCCTCTGCCCACACAGAAGCAGG + Intronic
1073487938 10:103833207-103833229 CCTGCTGCCCAGCCATAAGTGGG + Intronic
1075563562 10:123486595-123486617 GCTGCAGCCCAGGCAGAGCCAGG - Intergenic
1076729114 10:132429520-132429542 CCTGCTGCCAACACAGGGCCTGG + Intergenic
1076819190 10:132930360-132930382 CCTCCTCCCCATACAGAGCCTGG + Intronic
1076819204 10:132930419-132930441 CCTTCTTCCCACACAGAGCCTGG + Intronic
1076819228 10:132930509-132930531 CCTCCTCCCCACACAGAGCCTGG + Intronic
1076819296 10:132930743-132930765 CCTCCTCCCCACACAGAGCCTGG + Intronic
1076819424 10:132931183-132931205 CCTCCTCCCCACACAGAGCCTGG + Intronic
1076819480 10:132931366-132931388 CCTCCTCCCCACACAGAGCCTGG + Intronic
1076819536 10:132931571-132931593 CCTCCTCCCCACACAGAGCCTGG + Intronic
1076819599 10:132931795-132931817 CCTCCTCCCCACACAGAGCCTGG + Intronic
1076819672 10:132932056-132932078 CCTGCTCCCCACACAGAGCCTGG + Intronic
1076819687 10:132932112-132932134 CCTCCTCCCCACACAGAGCCTGG + Intronic
1076819721 10:132932252-132932274 CCTCCTCCCCACACAGAGCCTGG + Intronic
1076819810 10:132932597-132932619 CCTCCTCCCCACACAGAGCCTGG + Intronic
1077072547 11:682659-682681 GCTGCCCCCCACACAGAACCCGG - Intronic
1077457567 11:2690058-2690080 CCTTCAGCCCAGACAGAAGCAGG - Intronic
1077485521 11:2836755-2836777 CTCGCTGACCAGGCAGAACCAGG + Intronic
1077498013 11:2896075-2896097 CCTGCTCACCAGCCAGAACTGGG - Intronic
1079347341 11:19664445-19664467 TCTGCTGACCAGTCATAACCAGG - Intronic
1080227273 11:29975062-29975084 CCTCCTCCCCAGGCAGAACTAGG + Intergenic
1080776844 11:35394307-35394329 CCTGCTGCTCAGTCACCACCGGG + Intronic
1081854117 11:46293335-46293357 CCTCCTGCCCAGACAGTGCCTGG + Intronic
1084332732 11:68439381-68439403 CCCGCTCCCCAGAGAGAATCAGG - Intronic
1084666792 11:70580713-70580735 CTGGCTGCCCAGCCAGAGCCAGG + Intronic
1084943778 11:72628049-72628071 GCTGCTGCCCAGCCAGTGCCAGG + Intronic
1085263569 11:75223346-75223368 CCGGCTGACCACTCAGAACCAGG + Intergenic
1085385200 11:76153601-76153623 ACTTCTGACCAGACAGAGCCTGG - Intergenic
1086280060 11:85174894-85174916 CATTCTCCCAAGACAGAACCAGG + Intronic
1087045089 11:93838083-93838105 TGTGCAGCCCAGATAGAACCTGG - Intronic
1089750600 11:120648563-120648585 CTGGCTGCCCAGAGAGAAGCTGG - Intronic
1089807262 11:121102278-121102300 TCTGCTGCAGAGACACAACCCGG + Intronic
1090799444 11:130161162-130161184 CCTGCACCACAGACAGGACCTGG + Intronic
1090975675 11:131678150-131678172 CCTGGGGCCCAGACTGGACCGGG + Intronic
1091302822 11:134518435-134518457 CCTGCTGCCCTGAGGGAACAGGG - Intergenic
1091605629 12:1949157-1949179 CCTCCTGCCCATACAGAGCCCGG - Exonic
1095103528 12:38205560-38205582 CCTGTTCCCCAGATGGAACCAGG - Intergenic
1096797050 12:54084460-54084482 TCTGCTTCCCAACCAGAACCTGG - Intergenic
1096976642 12:55703132-55703154 CCTGCTGCCCAGGAAGAGCCAGG + Exonic
1097277904 12:57825668-57825690 CCTGCAGCCCAGGCAGTCCCAGG - Intronic
1101469589 12:104984159-104984181 TCTGCTGTCCAGAAAGAATCAGG + Intergenic
1101738439 12:107481398-107481420 CCTGGTGCTCAGAGGGAACCAGG - Intronic
1101811487 12:108111759-108111781 CCAGCTGAGCAGGCAGAACCAGG + Intergenic
1102768826 12:115455564-115455586 ACTTCTGCCCAGACTGAACCTGG - Intergenic
1103074686 12:117972596-117972618 CTGGCTGCACAGACAGAACCTGG + Intergenic
1103242708 12:119428444-119428466 GCTGGTCACCAGACAGAACCAGG + Intronic
1103597042 12:122030339-122030361 TCTGCTGCCCAGACAGGCGCGGG + Intronic
1103715871 12:122945048-122945070 CCTCATGCCCAGCCAGAACTAGG + Intronic
1103946634 12:124531015-124531037 CCTGCTGTCCGGACAGGACACGG + Intronic
1104134870 12:125927829-125927851 CCTGCTGCATAGACAGAGCAGGG - Intergenic
1104261907 12:127192136-127192158 CCTGCTGTTCACACAGAACATGG + Intergenic
1104584496 12:130037148-130037170 TCTGCGGCCCAGAGAGCACCCGG + Intergenic
1105433397 13:20357781-20357803 CACGCTGCCCAGCCAAAACCAGG + Intergenic
1106075671 13:26458982-26459004 CCTTGTGCCCACACAGAACAAGG - Intergenic
1108697024 13:52911428-52911450 CATCCTGCTCAGACAGAGCCAGG - Intergenic
1113609791 13:111636143-111636165 TCTGCTGCCCAAACAGACTCTGG - Intronic
1114484394 14:23054404-23054426 CCTCCTCCCCAGCCAGATCCTGG - Intronic
1117252598 14:53951940-53951962 CCTCCTCCCCAGACTGAAGCCGG + Exonic
1117724343 14:58657935-58657957 CATGGTACCTAGACAGAACCAGG + Intergenic
1118520254 14:66575637-66575659 CCGGGTGCCCAGACACAACCAGG + Intronic
1119430798 14:74567046-74567068 CCTGCTTCCCAGACAGCTCAAGG + Intronic
1119653090 14:76397348-76397370 TCTGCTGCCCAGACTGGCCCTGG - Intronic
1119889921 14:78174922-78174944 CCTGCTGCCTTGACAGAGCCTGG + Intergenic
1120848390 14:89146744-89146766 CCTGCTGGCCATAGAGAACCTGG + Intronic
1121443850 14:93966238-93966260 CCTGTTGCCTAGACAAAGCCAGG - Intronic
1121873442 14:97430143-97430165 TCTGATGGCCAGACACAACCAGG + Intergenic
1122129851 14:99598637-99598659 CCTGCTGCCCAGAGAGTTCCAGG - Intronic
1122376550 14:101264384-101264406 CCTGCTGCTCACACAGGGCCAGG - Intergenic
1122826394 14:104372882-104372904 CCTGGTCCCCAGACTGCACCGGG + Intergenic
1122965791 14:105124952-105124974 CCTGCTGCACAGCCACGACCAGG + Intergenic
1123696160 15:22880618-22880640 ACTCCAGCCCAGACAGAAACCGG + Intronic
1125574176 15:40744149-40744171 ACTGCAGACCAGACAGAAACGGG + Exonic
1126092917 15:45067666-45067688 CCTGGTGCCCAGATAGCCCCAGG - Intronic
1126272079 15:46831728-46831750 CCTGATGCCCACATAGAGCCAGG + Intergenic
1126352954 15:47764256-47764278 ACTGCTGTCCAAACAGAATCTGG - Exonic
1126913381 15:53438231-53438253 CCTGCTGCCCAGGAAGAAAAGGG + Intergenic
1128551284 15:68599609-68599631 CACGCTGCCCAGACAGATCTGGG + Intronic
1129805215 15:78450683-78450705 CCTGCTGCTCTGACAGCACGTGG - Intronic
1130375872 15:83328057-83328079 CCTCCTGCCCAGAGAGGAACAGG + Intergenic
1131263630 15:90903007-90903029 CCGGCTGCCCCGACAGAGGCCGG + Exonic
1131544590 15:93305426-93305448 CCTGCTGAAAAGACAGAAGCTGG + Intergenic
1132332809 15:101024518-101024540 TCTGCAGCCCAGACAGAGCCAGG + Intronic
1132336312 15:101050646-101050668 CCTGCATCCCAGACAGCATCAGG + Intronic
1132468997 16:91415-91437 ACTGGAGCCCAGGCAGAACCTGG + Intronic
1132534690 16:472282-472304 ACTTCTGCCCACACAGACCCTGG + Intronic
1132633117 16:929298-929320 CCCGCTCTCCATACAGAACCAGG + Intronic
1132723324 16:1327517-1327539 CCTCCGGCCCAGCCAGACCCAGG - Intergenic
1132804566 16:1769549-1769571 TCTTCTGCCCAGGCAGAGCCTGG - Exonic
1133339598 16:5027890-5027912 CCGGCTGCCGAGACAAGACCGGG + Exonic
1133945521 16:10344696-10344718 ACTACTGCCTAGACAGAACAGGG + Intronic
1134811576 16:17171726-17171748 CCAGCTGCCCAGCCCCAACCTGG - Intronic
1135846635 16:25924847-25924869 CCTGCTGCCCTGCCAGACCAGGG - Intronic
1136498799 16:30659543-30659565 TCTGCTGCCCAGCCCGGACCCGG - Exonic
1137528647 16:49261670-49261692 CCAGCTTCCCTGACAGCACCAGG - Intergenic
1137564503 16:49524782-49524804 CCTGCTGCCCAGATGGCAGCCGG - Intronic
1138505173 16:57474944-57474966 CCTGCTGCCCTGCCCCAACCTGG - Exonic
1138517068 16:57541972-57541994 CCTGAAGCCCAGAGAGGACCTGG - Intergenic
1139232397 16:65296475-65296497 ACTGCTTCCCAGAGAAAACCAGG - Intergenic
1139636487 16:68261312-68261334 CCTGCTGACCAGGCAGGAGCAGG - Intergenic
1140893062 16:79301273-79301295 CCTGCTGACCAGCGAGACCCTGG + Intergenic
1141036720 16:80633042-80633064 CCTGCTGTCCAGTCAGACCTCGG - Exonic
1141309568 16:82900191-82900213 CCTGGTGGACAGAAAGAACCAGG + Intronic
1141733158 16:85835593-85835615 CCTGCTGCCCAGGCACGACCTGG - Intergenic
1141987569 16:87589812-87589834 CCGGCTGCCCAGCCAGAATGAGG + Intergenic
1142072380 16:88098382-88098404 CCTGCTGCCCAAAGACATCCTGG + Intronic
1143017085 17:3896639-3896661 CCTTCTGTTCAGACAGAGCCAGG + Exonic
1143307342 17:5958007-5958029 CCTGCAAACCAGACAGATCCGGG - Intronic
1143575323 17:7789206-7789228 CCCTCTGCCCACACAGTACCTGG - Intronic
1143670529 17:8393026-8393048 CCTGCTGCCCAGCCTGCCCCGGG - Exonic
1144064081 17:11608657-11608679 CCTGCCTCCCAGACTGGACCTGG - Intronic
1144687765 17:17237318-17237340 CCTGCTTCCCAGTCAGACCTCGG - Intergenic
1144737445 17:17563090-17563112 CCTGCTGCTGAGACAGATCTTGG - Intronic
1144787464 17:17840072-17840094 CCTCCAGTCCAGACAAAACCAGG - Intergenic
1144795481 17:17888552-17888574 GCTGCTGTCCACACAGAATCTGG + Intronic
1144959534 17:19037311-19037333 GCTGCTGACCAAACAGAACTGGG + Intronic
1144975625 17:19137213-19137235 GCTGCTGACCAAACAGAACTGGG - Intronic
1145239632 17:21232906-21232928 CCTTCTGCCCAGGCAGACCCAGG + Intergenic
1146548642 17:33761439-33761461 CCTGGTGCTCAGTCAGAGCCTGG - Intronic
1146943205 17:36858156-36858178 ACAGCTCCCCAGACAGAGCCTGG + Intergenic
1147540371 17:41352184-41352206 CCTGCTGCCTAGACTTACCCTGG - Intergenic
1147649509 17:42053970-42053992 GCTGCTTTCCAGGCAGAACCAGG - Intronic
1147981856 17:44279825-44279847 GCTGCTGCCCCGCCAGAGCCTGG - Intergenic
1148782294 17:50129177-50129199 CCTTCTCCCCAGTCAGAGCCCGG + Intronic
1149044538 17:52229106-52229128 CCTCCTGCCCAGGCAAAGCCGGG - Intergenic
1150337486 17:64341368-64341390 CCTGCTCCCCACACAGGCCCTGG - Intronic
1151595704 17:75077053-75077075 CCCGCTGCTCAGACACAGCCTGG - Intergenic
1151665927 17:75545132-75545154 TCAGCTGCACAGACAGAACTTGG - Intronic
1151819967 17:76492050-76492072 CCACCTGCCCAGCCAGATCCTGG + Intronic
1152300425 17:79492286-79492308 CCTGGTGCCCAGACACCCCCTGG + Intronic
1152743305 17:82028032-82028054 CCTTCTGCTCCGACAGAGCCAGG - Exonic
1152767772 17:82150293-82150315 CCTGGTGCACACCCAGAACCAGG + Intronic
1152767787 17:82150365-82150387 CCTGGTGCACACCCAGAACCAGG + Intronic
1152767840 17:82150617-82150639 CCTGGTGCACACCCAGAACCAGG + Intronic
1152783877 17:82238150-82238172 CGTGGTGCCCAGGCAGAGCCTGG - Intronic
1152801188 17:82331345-82331367 CCTGCTGCCCAGACAGAGCTGGG - Intronic
1152930297 17:83105826-83105848 CCTCCTTCTCAGACAGGACCTGG - Intergenic
1153771542 18:8420885-8420907 CCTGGGGCCCACACAGAGCCGGG - Intergenic
1153978241 18:10287978-10288000 CCTGCTGGGCAGTCAGAGCCAGG - Intergenic
1158324485 18:56299416-56299438 CCAGCTGCCCAGAAATTACCTGG - Intergenic
1160451240 18:78967343-78967365 GCTGATGGCAAGACAGAACCGGG + Intergenic
1160666051 19:329165-329187 GCTCCTGCCCAGACTCAACCTGG + Intronic
1161372014 19:3917852-3917874 CCTGCTGCCCAGAAGTCACCGGG - Intronic
1161428261 19:4216360-4216382 TGTGCTCACCAGACAGAACCAGG + Exonic
1161576132 19:5055478-5055500 CCTGCTGTCCAGACACACACAGG - Intronic
1161708254 19:5832403-5832425 CCCGCTTCCCAGACAGCACAGGG - Exonic
1161767241 19:6214472-6214494 CCTGCTGTCCAGAGCAAACCAGG - Intronic
1162496481 19:11025980-11026002 CCTGCTGCCCCGAGAGCCCCTGG + Intronic
1164051308 19:21587231-21587253 CCTGCTGTCCGGACAGGAGCGGG + Intergenic
1164618094 19:29678519-29678541 CCAGCTGCCCAGGCAGTCCCCGG + Intergenic
1165030981 19:32998082-32998104 CCTGCTGCCCCTTCAGAGCCTGG - Intronic
1166394169 19:42426659-42426681 CCTGCGGCCCAGGCTAAACCTGG - Exonic
926566675 2:14483285-14483307 CCTTCTCCCAAGACTGAACCAGG + Intergenic
927846533 2:26475216-26475238 CCAGCTTCCCAGCCAGCACCTGG + Intronic
928421366 2:31139560-31139582 TCTGCTCCCCAGACAGAGCAAGG - Intronic
928642639 2:33316503-33316525 CCTGCTGAGCAGACAAAACATGG + Intronic
929600112 2:43199556-43199578 TCTTCTTCCAAGACAGAACCAGG - Intergenic
929916573 2:46141906-46141928 CCTGCTGGCAGGGCAGAACCGGG - Intronic
930534925 2:52633283-52633305 CCTGCTGCCCAAACAGGGTCAGG - Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933258924 2:80110165-80110187 CCAACTGCCCAGTCAGACCCTGG + Intronic
935268548 2:101414607-101414629 CCTCCTGCCCTGAGAGAGCCAGG + Intronic
935544448 2:104386234-104386256 CCTCCTGCTCAGAAAGTACCTGG - Intergenic
936996905 2:118425139-118425161 CCTTCTTCCCAGACACAACAGGG - Intergenic
937062261 2:118989468-118989490 CCTCCTCCCCAGGCAGCACCAGG + Intronic
937215103 2:120307678-120307700 CCTCCTGCCCCGACAGGGCCAGG + Intergenic
938933330 2:136106560-136106582 CCTGCTGGTCAGACATAAGCTGG - Intergenic
939519371 2:143210299-143210321 CCTGTTTCCCAAACAGAACCTGG + Intronic
940918866 2:159286461-159286483 CCTGCTGCGCGGTTAGAACCGGG + Exonic
942646184 2:178112955-178112977 GCAGCTGACCAGACAGCACCTGG + Intronic
942715415 2:178886146-178886168 CCTGCTGACCTGGGAGAACCAGG + Intronic
945941249 2:215953085-215953107 CTTGCTGCCCAAACAAAAGCTGG + Intronic
947586523 2:231360204-231360226 GCTGATGCCCACCCAGAACCAGG - Intronic
948129429 2:235589568-235589590 CCTCCTGCCCATGAAGAACCAGG - Intronic
948572730 2:238927625-238927647 CCTGCACCCCACACAGAGCCTGG - Intergenic
948596240 2:239081522-239081544 CTTTCTGCCCAGAGAGACCCAGG - Intronic
948903165 2:240966238-240966260 CCTGTTGCCCAGGGAGAGCCTGG - Intronic
1168830823 20:844501-844523 CCTCCTGCCCCGGGAGAACCAGG - Intronic
1170746532 20:19104276-19104298 CCTGATACCCACTCAGAACCAGG + Intergenic
1171450149 20:25229988-25230010 CCTGCCGCCGAGAGAGAAGCAGG + Intergenic
1171848907 20:30294317-30294339 TCTGCTTCCCAACCAGAACCCGG - Intergenic
1175421216 20:58835072-58835094 CCTGTTCCCCAGAGAGGACCAGG - Intergenic
1176215514 20:63945957-63945979 GCTGCTGCTCAGTCAGCACCTGG + Exonic
1176383943 21:6127722-6127744 CCAGCTGCACAGGCAGGACCCGG - Intergenic
1176952470 21:15064335-15064357 CCTGCTGTCCAGCCGGATCCTGG - Intronic
1177730140 21:25018157-25018179 CTTGCTGCCATGACATAACCTGG - Intergenic
1179465379 21:41568230-41568252 CCTGCTGCCCAGACAGTGCCTGG - Intergenic
1179634112 21:42696503-42696525 CCTGCTGCCCACGCAGGTCCTGG + Intronic
1179739531 21:43410516-43410538 CCAGCTGCACAGGCAGGACCCGG + Intergenic
1180732047 22:17989455-17989477 CCCACCACCCAGACAGAACCCGG + Intronic
1181107999 22:20585969-20585991 CCTCCTGCACAGACAGCAGCGGG + Intronic
1181311186 22:21945842-21945864 CCTGCTGCCCAGAAAGCCCATGG + Exonic
1181822038 22:25484015-25484037 GCTGCTGCCCAGAAAGTGCCAGG + Intergenic
1181991836 22:26842707-26842729 CCTTCTGTCCATACAGAACAGGG + Intergenic
1183191500 22:36324520-36324542 CCTGCGGCCCAGGCCAAACCTGG + Intronic
1183279453 22:36924208-36924230 CCTGCTGCTCTGACACAACAGGG + Intronic
1183583745 22:38740281-38740303 CCTGCTGCCCCAGCAGATCCAGG - Exonic
1184290876 22:43497599-43497621 CCTGCTCCCCAGCCAAGACCTGG - Intronic
1184353867 22:43964961-43964983 ACTGCTCCACAGACAGAGCCAGG - Intronic
950084636 3:10248681-10248703 CCTGCGGCCCAACCAGACCCGGG - Exonic
952820541 3:37482223-37482245 CCTGCAGCCCAGGCAGATGCTGG + Intronic
954128590 3:48547952-48547974 CCTGTGGCCCAGCCAGAGCCAGG + Intronic
954284813 3:49611438-49611460 CCTGCTCCCCAGCCAGCCCCAGG - Intronic
959093836 3:101932508-101932530 CCTGGTGCCCAGACGCCACCTGG - Intergenic
959127495 3:102307874-102307896 CCTGCTGCCTAGAGAGATCTTGG + Intronic
961608257 3:128114558-128114580 ACTGCAGGCCAAACAGAACCAGG - Intronic
962829281 3:139125810-139125832 CCTGCTGAGCAGACAGAAGTGGG + Intronic
966757457 3:183384762-183384784 CCTGCTGCCCAGACAGAACCAGG - Intronic
967475432 3:189911176-189911198 CCACCTGCCCTGACACAACCAGG + Intergenic
967852498 3:194093063-194093085 GCTGCTGCCCAGAGAGAAAGAGG + Intergenic
968730249 4:2266050-2266072 CCTGGTGCCGGGACACAACCAGG - Intergenic
968787412 4:2632922-2632944 CCTGGTGCCCAGAGAGACTCTGG + Intronic
968793694 4:2687846-2687868 GCTGCTGCCCACACTCAACCTGG + Intronic
969549579 4:7855811-7855833 ACTGCTGCACACACCGAACCTGG - Intronic
969720463 4:8890659-8890681 CCTGCTGCCCGGGCACAGCCAGG - Intergenic
976002103 4:80386240-80386262 CCTGCAGCCCCGCCAGAGCCAGG + Intronic
976402577 4:84623926-84623948 CATGCTCCCCATTCAGAACCCGG - Intronic
977314076 4:95423289-95423311 CATGCTGCCCAGAAAGCACAGGG + Intronic
982274047 4:153621828-153621850 CCTGCTGCCCAGAGAGAGGCAGG + Exonic
985579002 5:686910-686932 CCTGCTTCCAAGACAGGGCCTGG - Intronic
985593848 5:778973-778995 CCTGCTTCCAAGACAGGGCCTGG - Intergenic
988593438 5:32568897-32568919 CCTGGTGCCCACACTGACCCTGG - Intronic
990415474 5:55581862-55581884 CATGTTGCCCAGACTGATCCTGG - Intergenic
994817435 5:104601953-104601975 CCTTCGGTGCAGACAGAACCTGG - Intergenic
996057310 5:118995556-118995578 CCTGCTGCTCAAACAAAACAAGG - Intergenic
997604396 5:135163676-135163698 CCTGGTGCCCAGCTAGCACCAGG - Intronic
997948549 5:138223641-138223663 CTTGCTGCCCTGAAGGAACCAGG + Intergenic
998257833 5:140602313-140602335 ACTGCTGTCCAGTCAGAGCCAGG + Intergenic
998379205 5:141712007-141712029 CCTGGAGGCCAGACAGAGCCTGG - Intergenic
999203447 5:149832498-149832520 CCAGCTTCCCACACAGAGCCGGG - Intronic
999624176 5:153502644-153502666 CCTGCTGTCCAGAAAGCACAGGG + Intronic
1000790631 5:165602560-165602582 CCTGCTGCTGAGACAGGATCTGG + Intergenic
1001429456 5:171647763-171647785 GCCTCTGCCCAGAGAGAACCTGG - Intergenic
1001693047 5:173647005-173647027 CATGCGGCCCACACAGACCCAGG + Intergenic
1001905421 5:175468360-175468382 CCTGCTTCCCTGACAGAGCATGG - Intergenic
1002175192 5:177397677-177397699 CCTGCTGCCCAGACCAGATCGGG + Intronic
1004186515 6:13426015-13426037 CATGCTGCTCACACAGAAGCAGG + Intronic
1004329095 6:14705214-14705236 CATGCTGGCCAGACAGAAACAGG + Intergenic
1004447821 6:15717034-15717056 ACTGCTGCCCAAACAGAATTGGG - Intergenic
1007078097 6:39080564-39080586 CCAGCGGCCCAGGCAGATCCAGG - Intronic
1008208432 6:48690884-48690906 CCTGCTCCCAAAACTGAACCAGG + Intergenic
1009718729 6:67435679-67435701 CCTGTTGCCCAGAAGGAAACAGG + Intergenic
1011261101 6:85470250-85470272 CTTGCTGCACACAGAGAACCTGG + Intronic
1013057962 6:106603527-106603549 CCTCCTGCCCTGACTGATCCAGG - Intronic
1014183688 6:118411386-118411408 CATGCTCCCAAGACTGAACCAGG + Intergenic
1015959513 6:138632248-138632270 CCTGACTCCCAGACAGCACCTGG + Intronic
1016778143 6:147928379-147928401 CATCCTGCCAAGACTGAACCAGG - Intergenic
1016987116 6:149904037-149904059 CCTGCTGCCCTGCCACAGCCAGG - Intergenic
1017428602 6:154347715-154347737 CCTACTGCCCAGAAAGTTCCAGG + Intronic
1018207005 6:161445567-161445589 CCTGCTGCCCTGTCAGACGCTGG - Intronic
1018867759 6:167759024-167759046 CCTGCTGCCCTGACAGCCCCAGG + Intergenic
1019807639 7:3139985-3140007 CCTGCTGCTCTGACGGAGCCTGG + Intergenic
1020047192 7:5049240-5049262 CCTGCTGCCCAAGGAGAACTTGG + Intronic
1020292553 7:6733098-6733120 CCTGCTGCCCAAGGAGAACTTGG + Intergenic
1021180231 7:17497461-17497483 CCTGATGCCCAGGCTGAACCTGG - Intergenic
1023845781 7:44119374-44119396 CCTGCTGCCTGGGAAGAACCAGG + Intronic
1024232255 7:47371489-47371511 CCACCTGCCCAGAGAGCACCAGG + Intronic
1026727704 7:72882566-72882588 CCTGCTGCCCAAGGAGAACTTGG + Intronic
1027116135 7:75483159-75483181 CCTGCTGCCCAAGGAGAACTTGG - Intronic
1027121362 7:75524461-75524483 CCTGCTGCCCAAGGAGAACTTGG - Intergenic
1027275693 7:76552538-76552560 CCTGCTGCCCAAGGAGAACTTGG + Intergenic
1028880820 7:95877680-95877702 CTAGCTTACCAGACAGAACCAGG + Intronic
1029539706 7:101175420-101175442 TCTGCTGTCCACACAGACCCTGG + Intronic
1029721397 7:102367093-102367115 CCTGCTGCCCAAGGAGAACTTGG + Intronic
1031957906 7:127960874-127960896 CCAGCTGCCCAGAAACATCCTGG + Intronic
1034217763 7:149421343-149421365 CCTGCTCCCCACACAGAACTAGG + Intergenic
1034512277 7:151545726-151545748 CCTGCTGCCCAGCCAGAAGCTGG - Intergenic
1034646571 7:152652970-152652992 CCTGCTGCCCAGAGACCACAGGG + Intronic
1035662189 8:1356488-1356510 CCACCAGCACAGACAGAACCAGG - Intergenic
1035783006 8:2243790-2243812 CATTCTGCCCAGACAGCCCCAGG + Intergenic
1035809121 8:2475796-2475818 CATTCTGCCCAGACAGCCCCAGG - Intergenic
1036440756 8:8779764-8779786 CCTGCTGCCAAGTCAGAAGCGGG - Intergenic
1037608513 8:20457380-20457402 CCTGCTGCCCAGCCAACTCCTGG + Intergenic
1037766012 8:21772689-21772711 CCTGCTGCCCAGAGATAACTGGG - Intronic
1040542929 8:48376102-48376124 TCAGCTGGCCAGACAGAGCCTGG + Intergenic
1040578437 8:48674930-48674952 CCTGGTTCCCAGGCAGAGCCTGG - Intergenic
1043035853 8:75197810-75197832 TGTTCTGCACAGACAGAACCTGG + Intergenic
1048004392 8:130407348-130407370 CTAACTGCCCAGACACAACCAGG + Intronic
1048875424 8:138833439-138833461 CCTGCGGCCCTCACACAACCAGG - Intronic
1049096305 8:140550303-140550325 CCTGCTGCCCCCACAGAGCGGGG + Intronic
1049807167 8:144546298-144546320 CCTGCTGCTCTGAGAGAACCTGG + Intronic
1050165226 9:2758354-2758376 CCCACTGCACAGACAAAACCAGG + Intronic
1053429428 9:38032408-38032430 CCTGTTGCCCAGAAGGAGCCTGG - Intronic
1053786619 9:41657037-41657059 TCTGCTTCCCAACCAGAACCTGG - Intergenic
1054450308 9:65400258-65400280 TCTGCTTCCCAACCAGAACCTGG - Intergenic
1054769001 9:69067236-69067258 CCTGCTGCCCACACAGACTGCGG + Intronic
1054818103 9:69495387-69495409 CCAGCTGCCCAAACAGCACCCGG - Intronic
1054931111 9:70636309-70636331 CTTGCAGCCCATACAGAAACAGG + Intronic
1056308777 9:85319295-85319317 CCTGCTGCCCACACAGACTGTGG + Intergenic
1057025952 9:91733868-91733890 CCTTCTCCCCAGACAGATCTGGG - Intronic
1057434094 9:95023422-95023444 CCTGCCTCCCAGGCAGACCCAGG + Intronic
1058120732 9:101135837-101135859 CCTGCTGGGCAGACAGAGGCAGG - Intronic
1059076938 9:111203381-111203403 CCCTCTCCCCAGACTGAACCAGG + Intergenic
1059322612 9:113481338-113481360 ACTGCTGGCCAGAGAGACCCAGG + Intronic
1060246697 9:121952528-121952550 CCTCCTCCCCAAACAGAAGCTGG - Intronic
1060294894 9:122336775-122336797 CCTGTGGCCCAGACAGCCCCAGG - Intergenic
1060517759 9:124276402-124276424 CCTGCTCCCAAGCCAGATCCAGG - Intronic
1060786221 9:126453370-126453392 CCTTCTGCCCAGCCAGGCCCTGG - Intronic
1062324310 9:136004979-136005001 CTTGCAGCCCCGACAGAAACCGG - Intergenic
1062348393 9:136126243-136126265 CCTGCTGCCCGGAGAAGACCAGG - Intergenic
1185828051 X:3271873-3271895 CCTGCTACCCAGAGAGAAAAGGG + Exonic
1186492401 X:9984209-9984231 CCTGCTGCCAATACAGAGCCAGG + Intergenic
1187111937 X:16311214-16311236 CCTTGTTCCCAGACAGAACAAGG - Intergenic
1187393823 X:18903487-18903509 TCTGCTGCCCAGACAGGGCCTGG - Intronic
1188900789 X:35730813-35730835 CATGCTCCCAAGACTGAACCAGG - Intergenic
1191111718 X:56808471-56808493 CCTTCTCCCAAGACAAAACCAGG - Intergenic
1191845561 X:65545089-65545111 CCGTCTGCCCATAGAGAACCTGG - Intergenic