ID: 966759907

View in Genome Browser
Species Human (GRCh38)
Location 3:183408468-183408490
Sequence GGTCCCTAGGGGCCAGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966759907_966759914 -7 Left 966759907 3:183408468-183408490 CCTGGTTCTGGCCCCTAGGGACC 0: 1
1: 0
2: 0
3: 10
4: 162
Right 966759914 3:183408484-183408506 AGGGACCTATGGCCATGGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 148
966759907_966759916 -5 Left 966759907 3:183408468-183408490 CCTGGTTCTGGCCCCTAGGGACC 0: 1
1: 0
2: 0
3: 10
4: 162
Right 966759916 3:183408486-183408508 GGACCTATGGCCATGGGCAGGGG 0: 1
1: 0
2: 0
3: 23
4: 257
966759907_966759915 -6 Left 966759907 3:183408468-183408490 CCTGGTTCTGGCCCCTAGGGACC 0: 1
1: 0
2: 0
3: 10
4: 162
Right 966759915 3:183408485-183408507 GGGACCTATGGCCATGGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966759907 Original CRISPR GGTCCCTAGGGGCCAGAACC AGG (reversed) Intronic
900571014 1:3358249-3358271 GGTCCCCAGGAGGCAGAACCGGG - Intronic
902372561 1:16015465-16015487 GGTGCGTGGGGGCTAGAACCTGG + Exonic
902968421 1:20029198-20029220 GGTGCCAAGCGGCCTGAACCAGG - Intronic
904832177 1:33312264-33312286 GGTCCCTAGGGCTCAGCACTGGG - Intronic
905369720 1:37476606-37476628 GGTTCCCCGGGGCCAGAGCCAGG + Intronic
905385853 1:37603594-37603616 GGTCTCTAGGGGCTACACCCAGG + Intergenic
905489395 1:38331848-38331870 GGTCCCCAGTGGCCAGACTCTGG - Intergenic
905793324 1:40801815-40801837 TGGCCCTCGGGGCCAGGACCTGG + Intronic
917973801 1:180225929-180225951 TGTCCCTTTGGGCCAGGACCTGG - Intergenic
918030316 1:180801360-180801382 GGTCCCTAGGAGCTAAAAGCAGG + Intronic
920047515 1:203142969-203142991 GGTCCCCTGGGGCCATAACTGGG + Intronic
920260122 1:204683650-204683672 TGTTCCTAGGTGCCAGACCCTGG + Intronic
920301685 1:204992751-204992773 GGTCCCAGGGTGCCAGAACAGGG - Intronic
922455723 1:225771900-225771922 GGTCCCTAGGGGTCAGCTCTGGG + Intergenic
922717201 1:227883916-227883938 GGTCCGTCGGGGCCAGAGCTAGG - Intergenic
923564987 1:235069922-235069944 GGTCCCTAGGGGACAGGGACTGG - Intergenic
923892702 1:238233954-238233976 GGTCTCTAGTGGCCTGTACCTGG - Intergenic
1068754243 10:60632775-60632797 GGTCCCTAGGAGGCTGAAGCAGG + Intronic
1070594089 10:77820400-77820422 GGTTCCTGGGGGGCAGAAACTGG - Intronic
1070915915 10:80154687-80154709 GGTCCCCAGAGACCAGAGCCAGG + Exonic
1073069954 10:100787092-100787114 GGTTCCTAAGGGCCAGAGCATGG + Intronic
1076768223 10:132649023-132649045 GGGCCCTGTGGGGCAGAACCAGG - Intronic
1076803347 10:132843275-132843297 TGTCCCTAAGGCCCAGGACCTGG + Intronic
1078107118 11:8365499-8365521 TGTCCCCAGGGGCCTGACCCAGG + Intergenic
1078561999 11:12380285-12380307 GGTCCCTAGGGGCTAGCAACAGG + Intronic
1078987484 11:16609927-16609949 TGTCTCTAGGGGCCAGAGCCTGG + Intronic
1081532203 11:43969720-43969742 GGGCCCTGGGGACCAGCACCAGG - Intergenic
1082160259 11:48882329-48882351 GGTACCTTGGGGCCAGCACAGGG + Intergenic
1082162107 11:48898077-48898099 GGTACCTTGGGGCCAGCACAGGG - Intergenic
1083322489 11:61856165-61856187 GGTCCCTAGGGGCTGGACCATGG + Intronic
1083712453 11:64557568-64557590 GGTGCTGAGGGGCCAGAAGCAGG + Intronic
1084173255 11:67410547-67410569 GGTCCCGAGGGGGCAGACGCAGG - Intronic
1084698627 11:70771374-70771396 GGTCCCTGGGCGCCTGACCCAGG + Intronic
1085451147 11:76634373-76634395 GGTCCCTAGTGCCCAGCACAGGG + Intergenic
1090938564 11:131367188-131367210 AGCCCCTAGGGGACAGAACTGGG + Intergenic
1093051472 12:14509675-14509697 GGACCCTAGGGATCAGGACCTGG - Intronic
1093556900 12:20486853-20486875 GGTCACTTGAGGCCAGAAGCTGG - Intronic
1097107727 12:56635156-56635178 GTCTCCTAGGGGCCAGAACCAGG + Intronic
1101842372 12:108337476-108337498 GGCCCCTAGAGGCCAGATCTGGG - Intronic
1102521098 12:113477777-113477799 GATCCCTGGGGGCCAGAAGGGGG + Intergenic
1104476380 12:129073922-129073944 AGTCCCCAGGGTCCAGATCCTGG + Exonic
1105854471 13:24362029-24362051 GGGCCCTTGGGGGCAGGACCAGG - Intergenic
1106419550 13:29574442-29574464 GGCCCATAAGGGCAAGAACCTGG + Intronic
1107964862 13:45589208-45589230 GGTCCCCAGGGGCCAGATCTGGG - Intronic
1108890966 13:55258879-55258901 GCTCCCTAGGGGCAGGAATCAGG + Intergenic
1113672312 13:112183400-112183422 CGTCCCGAGGGGCCAGCCCCGGG - Intergenic
1113708628 13:112449749-112449771 GGTTCCTAGGGGCCGGAGGCTGG - Intergenic
1115645347 14:35365478-35365500 GGCCCCTCAGGGCCAGGACCAGG - Intergenic
1122344456 14:101049935-101049957 GGTCCCTGGGGGCAAGGACAAGG + Intergenic
1122429634 14:101632176-101632198 GGTCCCTAAGGGACAGAGCAAGG + Intergenic
1127479345 15:59364283-59364305 GGTACCTTTGGGCTAGAACCTGG + Intronic
1128085600 15:64884249-64884271 GGGCCCTAGGGGAAAGAGCCTGG + Intronic
1131829440 15:96344775-96344797 GGTCGCTGGGGGCCAGAGGCCGG + Intergenic
1133278224 16:4650661-4650683 GGCCTCTAGGGGGCAGCACCAGG - Intronic
1135521641 16:23182687-23182709 GGTCCCTAGGGGGCGGGGCCTGG + Intergenic
1135627378 16:24007865-24007887 GGTCTCTTGAGTCCAGAACCAGG - Intronic
1135629420 16:24024048-24024070 GAACCCCAGGGACCAGAACCAGG + Intronic
1136629199 16:31479475-31479497 GGTCCCTAGAGTCTAGACCCAGG - Intergenic
1138111741 16:54329676-54329698 AGTCCCCAGAGGCCAGTACCTGG - Intergenic
1139390509 16:66604521-66604543 GGTCTCCAGCGGCCCGAACCAGG + Intronic
1140833221 16:78770455-78770477 GGTCCCCACGGGCCAGGACTGGG + Intronic
1140933913 16:79653312-79653334 GGTTCCAATGAGCCAGAACCTGG - Intergenic
1141720522 16:85752809-85752831 GGTCCCAAGGGGCCATTTCCTGG + Intergenic
1144787086 17:17837896-17837918 TGTCCCTAGGCCACAGAACCAGG - Intergenic
1145089986 17:19978123-19978145 GGTACCCAGGGGCCGGAAGCCGG - Intronic
1146848534 17:36201634-36201656 GGAGCCTCGGGGCCAGAATCTGG - Intronic
1147031714 17:37643315-37643337 GGTCCCTTGGGCACAGTACCTGG + Exonic
1149171507 17:53817244-53817266 AATCTCCAGGGGCCAGAACCTGG - Intergenic
1151746869 17:76016313-76016335 AGTCCCTAGTGGGCAGAGCCAGG - Intronic
1152768845 17:82155432-82155454 GGTCCCCAAGGACCAGAACTAGG - Intronic
1156118761 18:33818463-33818485 GGTCCCAAGGGCTGAGAACCAGG - Intergenic
1156202760 18:34853013-34853035 GGTCCCTGGAGCCCAGAACCAGG + Intronic
1157482023 18:48061046-48061068 GCTCTCTAGTGGCCAGAACAGGG - Intronic
1159587646 18:70296485-70296507 GGTCACCATAGGCCAGAACCAGG + Intronic
1159829689 18:73260258-73260280 GGACTCTAGAGGCCAGAACAAGG + Intronic
1160390446 18:78527502-78527524 GGTCTCTAGGGTCCAGCACGGGG - Intergenic
1161358295 19:3831874-3831896 GGTCCCTAGGGGACAGGGACAGG + Exonic
1164576500 19:29408299-29408321 GGCCTCTAGGGGCCAGAAAGTGG - Intergenic
1165445556 19:35855250-35855272 TGTCCCTAGGTGCCAGAGCGTGG + Intronic
1165449073 19:35871869-35871891 GCTCCCCGGGGGCCAGGACCGGG - Exonic
1167354062 19:48992767-48992789 CTTCCCTAGGACCCAGAACCCGG + Intronic
928424497 2:31166869-31166891 TGACACTTGGGGCCAGAACCTGG - Intergenic
930770784 2:55128510-55128532 TGTCCCCAGGGGACAGAATCTGG - Intergenic
931998393 2:67861176-67861198 GGTCCCTACTGGACAGAACTTGG + Intergenic
932327276 2:70871571-70871593 GCTCCCTAGGGTCCAGAAATGGG - Intergenic
937037493 2:118794051-118794073 GGTCTCTAGAGGCCTCAACCTGG + Intergenic
937223874 2:120357112-120357134 GGTCCCCAGGGGCCAGGGTCAGG + Intergenic
940919005 2:159286910-159286932 TGACCCTAGGAGCCAGAAGCTGG - Intergenic
941494923 2:166188064-166188086 GGTCCCAAGGAGACAGAAGCAGG + Intergenic
942321657 2:174741545-174741567 GATGCCTGGGGACCAGAACCTGG + Intergenic
942928664 2:181462916-181462938 GATGCCTAAGGGCCTGAACCTGG + Intronic
947630854 2:231652178-231652200 GGTCCGAAGGGGCCTCAACCTGG + Intergenic
948372970 2:237502366-237502388 GGTCCCTTGGGTCCAGGACAGGG - Intronic
1168880623 20:1203531-1203553 GATCCCTCGGGCCCAGAACCAGG + Exonic
1170114939 20:12847293-12847315 GGTCTCTACTGGCCAGAACTGGG - Intergenic
1173840170 20:46151924-46151946 GGGCCCTAGGGGCCAGTCCCAGG - Intergenic
1175165537 20:57041303-57041325 GTCCCCAAGGGGCCAGAAGCGGG - Intergenic
1175499114 20:59437020-59437042 GCTCCCTAGAGCCCAGAAGCAGG + Intergenic
1176215822 20:63947279-63947301 GTCCCCTAGGGGACAGAGCCTGG - Intronic
1176707044 21:10124891-10124913 GGTCCCTGGGGCCTAGCACCGGG - Intergenic
1177777254 21:25581744-25581766 GATCGCTAGAGGCCAGAAGCTGG + Intergenic
1179587730 21:42384351-42384373 TGTCCCTAGGGGCCAGGAGGTGG - Intronic
1180083913 21:45498960-45498982 TGTCCCTGGGAGCCAGAACGAGG + Intronic
1181026261 22:20129515-20129537 GGTCCCGTGGGGCCAGCACGCGG - Intronic
1181049485 22:20231836-20231858 GGGCCCCAGGGCCCAGAGCCAGG + Intergenic
1181305194 22:21912528-21912550 GGTCCCATGGGGCCTGCACCTGG + Intergenic
1183273143 22:36874401-36874423 GGTCCCTAGCGTCCAGGCCCTGG + Intronic
1183359363 22:37375574-37375596 GGTGCCTAGCGGCCAGAGGCTGG + Exonic
1183942326 22:41302503-41302525 CGTCCCCAGGCGCCAGAGCCGGG - Intronic
1185324175 22:50217566-50217588 GGTCCCTGGGGGCTGGACCCAGG + Exonic
949866462 3:8551509-8551531 GGTTTCTATGGGGCAGAACCTGG + Intronic
950116007 3:10450683-10450705 GGTCCCTATGGACCAGCACCAGG + Intronic
951537404 3:23752244-23752266 CCTCCCTAGGGGGCAGGACCAGG + Intergenic
954627199 3:52029010-52029032 AGTCCCTAAGGGCCCTAACCAGG + Intergenic
958779800 3:98526661-98526683 GGACCCTAGGGTCCAGAAAGGGG - Intronic
959154213 3:102647116-102647138 GGTCAGTAGAGGCCAGAACATGG - Intergenic
961449219 3:126994955-126994977 GGTCCCCAGGGCCCAGCTCCAGG - Intronic
966759907 3:183408468-183408490 GGTCCCTAGGGGCCAGAACCAGG - Intronic
966824650 3:183953492-183953514 GGTCCCTAGGGGTGGGGACCTGG - Intronic
968943181 4:3649961-3649983 GCTCCCGAGGGGCCAGGCCCTGG - Intergenic
969295674 4:6269653-6269675 GGGCCCGAGGGGCCAGAAGGCGG - Intergenic
973803183 4:54498486-54498508 TGTCCCTAGGGCTCAGAACAGGG + Intergenic
978480523 4:109184946-109184968 GGGCCCTGGAGGCCAGAATCAGG - Intronic
980932391 4:139194353-139194375 GGTCCCTAGGGACACGAAACGGG + Intergenic
981702021 4:147617578-147617600 GGTCCCTAGAGGCCGGTTCCTGG + Exonic
986637202 5:9835147-9835169 AGTTCCTAGGGGCCAGCACATGG + Intergenic
990448860 5:55917414-55917436 GGTCCTTTGGGCTCAGAACCTGG - Intronic
993503169 5:88684442-88684464 GGTGCCCAGGGGCAAGAGCCCGG + Intergenic
995341273 5:111063360-111063382 GAACCCTAGGGACCAGACCCTGG - Intergenic
997639172 5:135437370-135437392 GGTCCCTGGAGGGCAGAAGCTGG + Intergenic
999146713 5:149400822-149400844 AGTCCCAAGGAGCAAGAACCAGG + Intronic
999476013 5:151899558-151899580 AGTCCCTTGGGGTCAGAGCCGGG - Intronic
1005831291 6:29673078-29673100 GGGTCCTATGGCCCAGAACCAGG - Exonic
1006441369 6:34055729-34055751 GGGCCCTAGGGCTCAGACCCAGG + Intronic
1006576925 6:35053315-35053337 GGCCACTATGGGCCAGATCCAGG - Intronic
1007666512 6:43516708-43516730 GGTGCCTTGGGGCCATTACCTGG + Exonic
1009447652 6:63762483-63762505 GGTTCCTAGAGGACAGAAACAGG + Exonic
1015816569 6:137217647-137217669 GGTCTCAAGAGGCTAGAACCAGG - Intronic
1019196726 6:170287477-170287499 GGTCCCCATGAGCCAGAACCAGG + Intronic
1019345903 7:530856-530878 GGCACCTGGGGGCCAGAGCCAGG - Intergenic
1024097131 7:45991237-45991259 GGTAACTGGGGGCCAGAAGCAGG + Intergenic
1029042219 7:97588355-97588377 GGCCCAGAGGGGCCAGAATCAGG - Intergenic
1029618592 7:101675916-101675938 GGTAGCTAGGGGCCAGAAAATGG - Intergenic
1034781622 7:153887164-153887186 GGTCCCTAAGGGCAGGGACCCGG - Intronic
1042980325 8:74519199-74519221 GCTCCCCAGGAGCCAGGACCTGG - Intergenic
1045645569 8:104293851-104293873 AGTCCTTAAGGGCCTGAACCCGG + Intergenic
1048354349 8:133641243-133641265 GGTCCCTTGAGGGCAGGACCTGG + Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049261542 8:141641705-141641727 GGTCCCTGGGGGCAACAGCCAGG + Intergenic
1049587720 8:143439841-143439863 GGGCCCTGGGGGCCTGAGCCAGG + Intronic
1049587758 8:143439951-143439973 GGGCCCTGGGGGCCTGAGCCAGG + Intronic
1049587777 8:143440005-143440027 GGGCCCTGGGGGCCCGAGCCAGG + Intronic
1049610686 8:143553451-143553473 GGTCCTGGGGGGCCAGAGCCTGG - Exonic
1049800733 8:144516409-144516431 GGGCCCTGGGAGCCAGCACCAGG + Exonic
1049850404 8:144827391-144827413 GGGCCCGAGGGACAAGAACCTGG - Intergenic
1050331889 9:4554217-4554239 GCTGCCAAGGGGCCAGAGCCTGG + Intronic
1051596057 9:18825274-18825296 GGTCCCTAGAGCACAGAGCCTGG + Intronic
1053644346 9:40112046-40112068 GGTCCCTGGGGCCTAGCACCGGG - Intergenic
1053761812 9:41353441-41353463 GGTCCCTGGGGCCTAGCACCGGG + Intergenic
1054325195 9:63709289-63709311 GGTCCCTGGGGCCTAGCACCGGG - Intergenic
1054540405 9:66264561-66264583 GGTCCCTGGGGCCTAGCACCGGG + Intergenic
1055771036 9:79717304-79717326 GGACCCTAGGGCTAAGAACCTGG - Intronic
1056507757 9:87273558-87273580 GGTCGCTAGGGGCTTGAAGCAGG + Intergenic
1060530794 9:124346154-124346176 GGTCCCGAGGGTGCTGAACCTGG + Intronic
1062508985 9:136894510-136894532 GATCCATAGGGACCAGCACCGGG + Intronic
1202791789 9_KI270719v1_random:93764-93786 GGTCCCTGGGGCCTAGCACCGGG - Intergenic
1185709544 X:2292199-2292221 AGCGCCTTGGGGCCAGAACCTGG + Intronic
1189037159 X:37505255-37505277 GGTCGCTAGGGTCCCGAAGCGGG - Intronic
1190290529 X:48989296-48989318 GGTCACTAGGGCCTAGGACCAGG - Intronic
1192947596 X:75982967-75982989 CCTCCCTAGGGACCAGAATCAGG + Intergenic
1198449558 X:136753507-136753529 GGTCCCCAAGGCCCAGAATCAGG + Intronic
1200110180 X:153736984-153737006 GGTCCCTAGGGAACACAGCCAGG - Intronic
1200942079 Y:8794690-8794712 GTTCCCCATGGGCCAGACCCAGG - Intergenic