ID: 966762015

View in Genome Browser
Species Human (GRCh38)
Location 3:183427586-183427608
Sequence GCTTCTGACGGGAGTAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966762015_966762027 26 Left 966762015 3:183427586-183427608 CCCACCCTACTCCCGTCAGAAGC 0: 1
1: 0
2: 1
3: 9
4: 126
Right 966762027 3:183427635-183427657 GCCCTCGGTTTGGAGCTCAACGG 0: 1
1: 0
2: 1
3: 4
4: 66
966762015_966762023 11 Left 966762015 3:183427586-183427608 CCCACCCTACTCCCGTCAGAAGC 0: 1
1: 0
2: 1
3: 9
4: 126
Right 966762023 3:183427620-183427642 GGTAACAGCCCAGCAGCCCTCGG 0: 1
1: 0
2: 1
3: 20
4: 202
966762015_966762024 16 Left 966762015 3:183427586-183427608 CCCACCCTACTCCCGTCAGAAGC 0: 1
1: 0
2: 1
3: 9
4: 126
Right 966762024 3:183427625-183427647 CAGCCCAGCAGCCCTCGGTTTGG 0: 1
1: 0
2: 0
3: 11
4: 182
966762015_966762022 -10 Left 966762015 3:183427586-183427608 CCCACCCTACTCCCGTCAGAAGC 0: 1
1: 0
2: 1
3: 9
4: 126
Right 966762022 3:183427599-183427621 CGTCAGAAGCAGCTAACGGATGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966762015 Original CRISPR GCTTCTGACGGGAGTAGGGT GGG (reversed) Intronic
900079439 1:844608-844630 GGGTCTGCGGGGAGTAGGGTGGG + Intergenic
901828054 1:11875328-11875350 GCTTCCGATGGGAGGAGTGTCGG - Intergenic
902705245 1:18199894-18199916 GATTCTCACGGGGGTAGGGGGGG - Intronic
904055930 1:27669966-27669988 GCTTCTGACAGCAGAAGTGTGGG + Intronic
904483081 1:30806240-30806262 CCTTCTGCCGGCAGAAGGGTTGG + Intergenic
905316588 1:37085453-37085475 GTTTCTGAGGGGAGTAGGACTGG + Intergenic
905825618 1:41024011-41024033 GCTGCTGAGGGGAGAAGTGTTGG + Intergenic
906250275 1:44305740-44305762 GCTGCTGAGGGGAGAAGGGGAGG + Intronic
908712872 1:67037598-67037620 ACTTCTGACTAGATTAGGGTTGG - Intronic
911165879 1:94723947-94723969 GCCTCAGACTGGATTAGGGTTGG - Intergenic
912814829 1:112820648-112820670 GCTTCTAGCGGGATTAGGGGTGG + Intergenic
912897196 1:113604812-113604834 GATTCAGAAGGGAGGAGGGTCGG + Intronic
915161362 1:153922828-153922850 CCTGCTGACGGGACTAGGGACGG + Exonic
916453241 1:164941855-164941877 GACTCTGAAGGGAGGAGGGTGGG - Intergenic
916666745 1:166974292-166974314 CCTGCTGAAGGGAGTAGGATGGG - Intronic
918114421 1:181484305-181484327 GCATGTGAAGGGAGTAGGGGTGG - Intronic
920494681 1:206446308-206446330 GCTTGGGACGGGAGGAGGGGAGG + Intronic
924739724 1:246787989-246788011 GCTCCAGACTGGAGGAGGGTGGG + Intergenic
1063266592 10:4458229-4458251 GCTGCTTACGGGTGGAGGGTGGG - Intergenic
1064067888 10:12199041-12199063 CCTTCTGACGGTAGCAGGGTGGG + Intronic
1065715755 10:28566273-28566295 GCATATGCTGGGAGTAGGGTGGG + Intronic
1066004433 10:31133883-31133905 GAGTCTGGCGGGAGTAGGGAGGG - Intergenic
1072689574 10:97562963-97562985 GCTTCGGGCGGGATTAGGGGCGG + Intronic
1073081716 10:100864855-100864877 GCTCCTGACGGGTGGAGGGTAGG - Intergenic
1073436616 10:103520756-103520778 GCTTCCAGCGGGATTAGGGTTGG + Intronic
1074895525 10:117773912-117773934 GCTTCTGATGGGAATATGGTTGG - Intergenic
1075439185 10:122465957-122465979 GCTGCTGCATGGAGTAGGGTGGG - Intronic
1079509459 11:21194311-21194333 GCTTCTGACTGGAATGGGCTTGG + Intronic
1079746883 11:24143721-24143743 GCATATGATGGGAGTAGGGTGGG - Intergenic
1080487415 11:32724754-32724776 GCATGTGATGTGAGTAGGGTAGG - Intronic
1080811978 11:35713742-35713764 GCTCCTTAAGGGAGTAGAGTAGG + Intronic
1081711615 11:45220174-45220196 GCCTCTGACGGTGGTAGAGTGGG - Intronic
1083772764 11:64877776-64877798 GCTGCTGAGGGGAGTGGGGCTGG + Intronic
1085172798 11:74463289-74463311 GCTTCTGACAGGAGGAGGAAAGG + Intronic
1094040515 12:26116501-26116523 GCTTAGCACGGGAGCAGGGTCGG + Intergenic
1097081106 12:56431574-56431596 GCAGCTGGCGGGAGTAGGGCAGG - Exonic
1097174562 12:57135366-57135388 TCTGCTGAGGGGAGTGGGGTTGG + Intronic
1097615639 12:61880791-61880813 GCTGCAGGGGGGAGTAGGGTGGG - Intronic
1097715048 12:62957121-62957143 GCTCCAGAAGAGAGTAGGGTAGG - Intergenic
1097899637 12:64859682-64859704 GTTTCTGAGGGGAGGAGGATGGG + Intronic
1098038975 12:66335206-66335228 GCCTCAGCAGGGAGTAGGGTAGG + Intronic
1101446768 12:104742425-104742447 GCTGCTGGCAGGAGTAGGGGAGG - Intronic
1101575492 12:105993343-105993365 CTTCCTGGCGGGAGTAGGGTGGG + Intergenic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1103318655 12:120077335-120077357 GCCACTGATGGGAGTGGGGTAGG - Intronic
1110293922 13:73840423-73840445 GCTTGAGATGGGAGTTGGGTGGG - Intronic
1112019427 13:95358893-95358915 GCTTCTGATGGGAGGTGGGCAGG - Intergenic
1113099484 13:106701855-106701877 GCTAATGATGGGGGTAGGGTGGG + Intergenic
1116166981 14:41346398-41346420 CCTTTTGAAGGGAGGAGGGTGGG + Intergenic
1120539073 14:85732955-85732977 GCTTCTAGCGGGATTAGGGGTGG + Intergenic
1122697998 14:103566866-103566888 ACTTCTGAGAGGAGGAGGGTTGG + Intronic
1123036987 14:105475510-105475532 GTTTCACACGGGGGTAGGGTGGG + Intronic
1123842868 15:24267125-24267147 GATTCTGAAAGGAGGAGGGTTGG - Intergenic
1123857905 15:24433151-24433173 GATTCTGAAAGGAGGAGGGTTGG - Intergenic
1123862538 15:24483696-24483718 GATTCTGAAAGGAGGAGGGTTGG - Intergenic
1129360409 15:75020701-75020723 GCTTCTGGTGGGAGAAGGGAAGG - Exonic
1132849631 16:2019238-2019260 GCTTCTGCGGGGAGATGGGTTGG + Intronic
1136582333 16:31160594-31160616 GCTTCTGAGGGGAGCAGTTTTGG + Intergenic
1136592318 16:31224817-31224839 GGGTCTGACGGGAGAAGGGTGGG + Exonic
1147464012 17:40596686-40596708 GCTTCTGATTGGTGGAGGGTAGG + Intergenic
1147464022 17:40596784-40596806 GCTTCTGACTGCTGGAGGGTAGG + Intergenic
1147464028 17:40596833-40596855 GCTTCTGATTGGTGGAGGGTAGG + Intergenic
1149826107 17:59829771-59829793 GCTTGTAATGGGAGTAGGATAGG + Intronic
1150608357 17:66713448-66713470 GCTGCAGGTGGGAGTAGGGTGGG - Intronic
1154962509 18:21324013-21324035 GATTCTGAAGGGAGAAGGATGGG + Intronic
1158294315 18:55977941-55977963 GATTCAGAAGGGAGGAGGGTGGG + Intergenic
1161476284 19:4487545-4487567 GATTCAGAGGGGAGTAGGGCTGG - Intronic
1162471134 19:10872323-10872345 GCCTCTGCAGGGAGGAGGGTGGG + Intronic
1166104445 19:40590434-40590456 GCTTGGGACGGGATTGGGGTGGG - Intronic
1166917711 19:46206977-46206999 CCTTCTGCTGGGAGGAGGGTGGG - Intergenic
1167650699 19:50727030-50727052 TCTCCTGAAGGGAGAAGGGTGGG - Intergenic
1167659108 19:50785638-50785660 GTTTCAGAAGGGAGTGGGGTGGG - Intergenic
1168339897 19:55616809-55616831 GCTTTTGATGGGAGTGGGATGGG - Exonic
924989047 2:295488-295510 GCATCTGACGGAAGGAGGGAGGG - Intergenic
925101779 2:1253221-1253243 CCTTCTGTGGGGAGGAGGGTGGG - Intronic
933079684 2:77970283-77970305 GCTTCAAGCGGGATTAGGGTCGG - Intergenic
933164120 2:79056537-79056559 GCTTCGAACGGGATTAGGGGCGG - Intergenic
934758918 2:96842751-96842773 CCTGCTGACAGGAGCAGGGTAGG - Intronic
940426288 2:153535068-153535090 GCTTCAGGCGGGATTAGGGGCGG + Intergenic
942220447 2:173763629-173763651 GCTTTTAAAGGGAGTTGGGTGGG - Intergenic
1171823982 20:29878179-29878201 GAGGCTGACGGGAGAAGGGTTGG + Intergenic
1172957422 20:38771038-38771060 GCTTCTCACTGGAGTTGGGCTGG - Intronic
1175443415 20:59005834-59005856 GCTTTTGGCAGGAGTAGGGTAGG - Intronic
1178927975 21:36791831-36791853 GCTTTTGCCGGGGGTGGGGTGGG - Intronic
1179622843 21:42630245-42630267 GCTTCACACGAAAGTAGGGTTGG - Intergenic
1180141182 21:45894095-45894117 GCTGCTGACTGGAGCAGGGTAGG + Intronic
1181441100 22:22935577-22935599 GCCTGAGATGGGAGTAGGGTGGG + Intergenic
1182114013 22:27744545-27744567 GCTTCAAGCGGGATTAGGGTCGG - Intergenic
1184422755 22:44391441-44391463 GGTTCTCAGGGGAGCAGGGTGGG + Intergenic
1184859174 22:47163464-47163486 GCATCTGAAGGTGGTAGGGTCGG + Intronic
950898157 3:16472545-16472567 ACTTCTGACAGGTGTATGGTGGG + Intronic
951391611 3:22110846-22110868 GCTACTGAGGGGAATATGGTAGG + Intronic
954324721 3:49857162-49857184 GCTTGAGACTGTAGTAGGGTTGG + Intergenic
957527828 3:81399969-81399991 GGATCTGAAGGAAGTAGGGTAGG + Intergenic
960057189 3:113284113-113284135 TCTTCTGCAGGGAGAAGGGTGGG - Intronic
961164352 3:124753112-124753134 GCTTCAAACGGGATTAGGGGCGG + Intergenic
963569879 3:146980129-146980151 GCTGCTGACAGGAGTACTGTGGG + Intergenic
964553302 3:157909205-157909227 GATTCTGACGGCAGGAAGGTGGG - Intergenic
966762015 3:183427586-183427608 GCTTCTGACGGGAGTAGGGTGGG - Intronic
967977261 3:195042448-195042470 GCTTCTGAGGACAGCAGGGTGGG - Intergenic
968412224 4:400115-400137 GCTTCGAACGGGATTAGGGGTGG + Intergenic
968985718 4:3873374-3873396 CCTACTGAGGGGAGTAGGGAGGG + Intergenic
976739345 4:88342643-88342665 GCTTCCAGCGGGATTAGGGTTGG - Intergenic
981624638 4:146741801-146741823 AGTTGTGACGGGAGTAGAGTAGG - Intronic
985872526 5:2568739-2568761 GCATCTTCCAGGAGTAGGGTGGG + Intergenic
986505118 5:8441684-8441706 GCTTCTGAAGTGAGAAGAGTGGG + Intergenic
986554612 5:8998884-8998906 GCTTCTAGCGGGATTAGGGGTGG + Intergenic
990511532 5:56493486-56493508 GATCCTGAATGGAGTAGGGTGGG - Intergenic
992251791 5:74883267-74883289 GCTTCTAGCGGGATTAGGGGCGG + Intergenic
994370641 5:98963594-98963616 GCTTCTGCTGGGGGGAGGGTTGG + Intergenic
998917673 5:147033553-147033575 ACTTCTGACTGGAATGGGGTTGG + Intronic
1001521055 5:172393678-172393700 GATTCTGATGGGAGAGGGGTAGG - Intronic
1004424689 6:15499313-15499335 GCCGCTGGCGGGAGTTGGGTGGG + Intronic
1007774804 6:44219219-44219241 CCTTCTGACGGGTGTGGGGAGGG - Intergenic
1012338784 6:98092251-98092273 GCTACTGAGGGGACTAAGGTGGG + Intergenic
1017881973 6:158568329-158568351 GCTTCAGAGTGGGGTAGGGTGGG + Intronic
1018341148 6:162852254-162852276 CCATCTGACTAGAGTAGGGTGGG + Intronic
1019408146 7:894600-894622 GCTCCTGACGGGTGTTGGGGTGG - Intronic
1019935245 7:4250747-4250769 GATTCTGACTAGAGTGGGGTTGG - Intronic
1027518403 7:79171197-79171219 TCTTCTGAAGGCAGTAGGGAAGG + Intronic
1031422007 7:121564162-121564184 GCTTCGGGCGGGATTAGGGGTGG + Intergenic
1032002895 7:128276756-128276778 GCCTCAGAAGGGAGGAGGGTTGG + Intergenic
1034435926 7:151062743-151062765 GCTTCTGGTGGGAGTGGGGCTGG + Intronic
1035607324 8:938564-938586 GCTTCTGCAGGGAGCAGGGGAGG - Intergenic
1035632700 8:1120781-1120803 GGTTCTGAAGGGACTAGGATGGG - Intergenic
1036473561 8:9072772-9072794 GCTTCTGTCGGGAGTGGGGTGGG - Intronic
1046728383 8:117698772-117698794 GCTCCTTATGGGAGTAGAGTTGG + Intergenic
1050896512 9:10890176-10890198 GCTTCGGGCGGGATTAGGGTTGG - Intergenic
1051463350 9:17348890-17348912 GATTATGGCTGGAGTAGGGTGGG + Intronic
1052862707 9:33446842-33446864 GATTCTGACGGTAGAAGGGTGGG - Intronic
1053118910 9:35530579-35530601 GCATGTGACGGGAATGGGGTTGG + Intronic
1058108055 9:100997449-100997471 GCTACTGAAGGGTGAAGGGTGGG + Intergenic
1188005075 X:25011423-25011445 GCTTCTGGCGGGCTTAGGGGCGG - Intronic
1189048404 X:37617969-37617991 GCTTCAGTCAGAAGTAGGGTGGG + Intronic
1195245160 X:102988661-102988683 GCTTCTGATGGGGATAGGTTGGG + Intergenic
1196625183 X:117870226-117870248 GCTGCTGCTGGGAGTAGGGCAGG - Intergenic
1200021526 X:153214759-153214781 GCTTCTGAGGGGATTGGGCTGGG - Intergenic