ID: 966763716

View in Genome Browser
Species Human (GRCh38)
Location 3:183439654-183439676
Sequence TGAATCAGTCTACTATTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966763716_966763719 4 Left 966763716 3:183439654-183439676 CCCATCAATAGTAGACTGATTCA No data
Right 966763719 3:183439681-183439703 ACTATGGTACATACACACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966763716 Original CRISPR TGAATCAGTCTACTATTGAT GGG (reversed) Intergenic
No off target data available for this crispr