ID: 966767913

View in Genome Browser
Species Human (GRCh38)
Location 3:183479089-183479111
Sequence GGCTGGGGTTGGCCTGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966767913_966767920 -10 Left 966767913 3:183479089-183479111 CCTGAGCCAGGCCAACCCCAGCC No data
Right 966767920 3:183479102-183479124 AACCCCAGCCTCCCAGGGGGTGG No data
966767913_966767931 26 Left 966767913 3:183479089-183479111 CCTGAGCCAGGCCAACCCCAGCC No data
Right 966767931 3:183479138-183479160 AGCAGCCCCAGCATCATCCAGGG No data
966767913_966767925 -2 Left 966767913 3:183479089-183479111 CCTGAGCCAGGCCAACCCCAGCC No data
Right 966767925 3:183479110-183479132 CCTCCCAGGGGGTGGCTCTGTGG No data
966767913_966767930 25 Left 966767913 3:183479089-183479111 CCTGAGCCAGGCCAACCCCAGCC No data
Right 966767930 3:183479137-183479159 TAGCAGCCCCAGCATCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966767913 Original CRISPR GGCTGGGGTTGGCCTGGCTC AGG (reversed) Intergenic
No off target data available for this crispr