ID: 966767914

View in Genome Browser
Species Human (GRCh38)
Location 3:183479095-183479117
Sequence CTGGGAGGCTGGGGTTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966767914_966767931 20 Left 966767914 3:183479095-183479117 CCAGGCCAACCCCAGCCTCCCAG No data
Right 966767931 3:183479138-183479160 AGCAGCCCCAGCATCATCCAGGG No data
966767914_966767930 19 Left 966767914 3:183479095-183479117 CCAGGCCAACCCCAGCCTCCCAG No data
Right 966767930 3:183479137-183479159 TAGCAGCCCCAGCATCATCCAGG No data
966767914_966767935 28 Left 966767914 3:183479095-183479117 CCAGGCCAACCCCAGCCTCCCAG No data
Right 966767935 3:183479146-183479168 CAGCATCATCCAGGGCACAGAGG No data
966767914_966767925 -8 Left 966767914 3:183479095-183479117 CCAGGCCAACCCCAGCCTCCCAG No data
Right 966767925 3:183479110-183479132 CCTCCCAGGGGGTGGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966767914 Original CRISPR CTGGGAGGCTGGGGTTGGCC TGG (reversed) Intergenic
No off target data available for this crispr