ID: 966767919

View in Genome Browser
Species Human (GRCh38)
Location 3:183479100-183479122
Sequence ACCCCCTGGGAGGCTGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966767919_966767936 29 Left 966767919 3:183479100-183479122 CCAACCCCAGCCTCCCAGGGGGT No data
Right 966767936 3:183479152-183479174 CATCCAGGGCACAGAGGCCATGG No data
966767919_966767930 14 Left 966767919 3:183479100-183479122 CCAACCCCAGCCTCCCAGGGGGT No data
Right 966767930 3:183479137-183479159 TAGCAGCCCCAGCATCATCCAGG No data
966767919_966767931 15 Left 966767919 3:183479100-183479122 CCAACCCCAGCCTCCCAGGGGGT No data
Right 966767931 3:183479138-183479160 AGCAGCCCCAGCATCATCCAGGG No data
966767919_966767935 23 Left 966767919 3:183479100-183479122 CCAACCCCAGCCTCCCAGGGGGT No data
Right 966767935 3:183479146-183479168 CAGCATCATCCAGGGCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966767919 Original CRISPR ACCCCCTGGGAGGCTGGGGT TGG (reversed) Intergenic
No off target data available for this crispr