ID: 966767920

View in Genome Browser
Species Human (GRCh38)
Location 3:183479102-183479124
Sequence AACCCCAGCCTCCCAGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966767908_966767920 23 Left 966767908 3:183479056-183479078 CCAGGCTGTGGGTGTCTATGGCT No data
Right 966767920 3:183479102-183479124 AACCCCAGCCTCCCAGGGGGTGG No data
966767905_966767920 25 Left 966767905 3:183479054-183479076 CCCCAGGCTGTGGGTGTCTATGG No data
Right 966767920 3:183479102-183479124 AACCCCAGCCTCCCAGGGGGTGG No data
966767911_966767920 -8 Left 966767911 3:183479087-183479109 CCCCTGAGCCAGGCCAACCCCAG No data
Right 966767920 3:183479102-183479124 AACCCCAGCCTCCCAGGGGGTGG No data
966767912_966767920 -9 Left 966767912 3:183479088-183479110 CCCTGAGCCAGGCCAACCCCAGC No data
Right 966767920 3:183479102-183479124 AACCCCAGCCTCCCAGGGGGTGG No data
966767913_966767920 -10 Left 966767913 3:183479089-183479111 CCTGAGCCAGGCCAACCCCAGCC No data
Right 966767920 3:183479102-183479124 AACCCCAGCCTCCCAGGGGGTGG No data
966767907_966767920 24 Left 966767907 3:183479055-183479077 CCCAGGCTGTGGGTGTCTATGGC No data
Right 966767920 3:183479102-183479124 AACCCCAGCCTCCCAGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966767920 Original CRISPR AACCCCAGCCTCCCAGGGGG TGG Intergenic
No off target data available for this crispr