ID: 966767921

View in Genome Browser
Species Human (GRCh38)
Location 3:183479104-183479126
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966767921_966767930 10 Left 966767921 3:183479104-183479126 CCCCAGCCTCCCAGGGGGTGGCT No data
Right 966767930 3:183479137-183479159 TAGCAGCCCCAGCATCATCCAGG No data
966767921_966767936 25 Left 966767921 3:183479104-183479126 CCCCAGCCTCCCAGGGGGTGGCT No data
Right 966767936 3:183479152-183479174 CATCCAGGGCACAGAGGCCATGG No data
966767921_966767931 11 Left 966767921 3:183479104-183479126 CCCCAGCCTCCCAGGGGGTGGCT No data
Right 966767931 3:183479138-183479160 AGCAGCCCCAGCATCATCCAGGG No data
966767921_966767935 19 Left 966767921 3:183479104-183479126 CCCCAGCCTCCCAGGGGGTGGCT No data
Right 966767935 3:183479146-183479168 CAGCATCATCCAGGGCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966767921 Original CRISPR AGCCACCCCCTGGGAGGCTG GGG (reversed) Intergenic
No off target data available for this crispr