ID: 966767924

View in Genome Browser
Species Human (GRCh38)
Location 3:183479110-183479132
Sequence CCACAGAGCCACCCCCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966767924_966767931 5 Left 966767924 3:183479110-183479132 CCTCCCAGGGGGTGGCTCTGTGG No data
Right 966767931 3:183479138-183479160 AGCAGCCCCAGCATCATCCAGGG No data
966767924_966767935 13 Left 966767924 3:183479110-183479132 CCTCCCAGGGGGTGGCTCTGTGG No data
Right 966767935 3:183479146-183479168 CAGCATCATCCAGGGCACAGAGG No data
966767924_966767936 19 Left 966767924 3:183479110-183479132 CCTCCCAGGGGGTGGCTCTGTGG No data
Right 966767936 3:183479152-183479174 CATCCAGGGCACAGAGGCCATGG No data
966767924_966767938 26 Left 966767924 3:183479110-183479132 CCTCCCAGGGGGTGGCTCTGTGG No data
Right 966767938 3:183479159-183479181 GGCACAGAGGCCATGGACCCTGG No data
966767924_966767930 4 Left 966767924 3:183479110-183479132 CCTCCCAGGGGGTGGCTCTGTGG No data
Right 966767930 3:183479137-183479159 TAGCAGCCCCAGCATCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966767924 Original CRISPR CCACAGAGCCACCCCCTGGG AGG (reversed) Intergenic
No off target data available for this crispr