ID: 966767925

View in Genome Browser
Species Human (GRCh38)
Location 3:183479110-183479132
Sequence CCTCCCAGGGGGTGGCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966767912_966767925 -1 Left 966767912 3:183479088-183479110 CCCTGAGCCAGGCCAACCCCAGC No data
Right 966767925 3:183479110-183479132 CCTCCCAGGGGGTGGCTCTGTGG No data
966767914_966767925 -8 Left 966767914 3:183479095-183479117 CCAGGCCAACCCCAGCCTCCCAG No data
Right 966767925 3:183479110-183479132 CCTCCCAGGGGGTGGCTCTGTGG No data
966767911_966767925 0 Left 966767911 3:183479087-183479109 CCCCTGAGCCAGGCCAACCCCAG No data
Right 966767925 3:183479110-183479132 CCTCCCAGGGGGTGGCTCTGTGG No data
966767913_966767925 -2 Left 966767913 3:183479089-183479111 CCTGAGCCAGGCCAACCCCAGCC No data
Right 966767925 3:183479110-183479132 CCTCCCAGGGGGTGGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966767925 Original CRISPR CCTCCCAGGGGGTGGCTCTG TGG Intergenic
No off target data available for this crispr