ID: 966767926

View in Genome Browser
Species Human (GRCh38)
Location 3:183479113-183479135
Sequence GGACCACAGAGCCACCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966767926_966767931 2 Left 966767926 3:183479113-183479135 CCCAGGGGGTGGCTCTGTGGTCC No data
Right 966767931 3:183479138-183479160 AGCAGCCCCAGCATCATCCAGGG No data
966767926_966767938 23 Left 966767926 3:183479113-183479135 CCCAGGGGGTGGCTCTGTGGTCC No data
Right 966767938 3:183479159-183479181 GGCACAGAGGCCATGGACCCTGG No data
966767926_966767930 1 Left 966767926 3:183479113-183479135 CCCAGGGGGTGGCTCTGTGGTCC No data
Right 966767930 3:183479137-183479159 TAGCAGCCCCAGCATCATCCAGG No data
966767926_966767935 10 Left 966767926 3:183479113-183479135 CCCAGGGGGTGGCTCTGTGGTCC No data
Right 966767935 3:183479146-183479168 CAGCATCATCCAGGGCACAGAGG No data
966767926_966767936 16 Left 966767926 3:183479113-183479135 CCCAGGGGGTGGCTCTGTGGTCC No data
Right 966767936 3:183479152-183479174 CATCCAGGGCACAGAGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966767926 Original CRISPR GGACCACAGAGCCACCCCCT GGG (reversed) Intergenic
No off target data available for this crispr