ID: 966767935

View in Genome Browser
Species Human (GRCh38)
Location 3:183479146-183479168
Sequence CAGCATCATCCAGGGCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966767923_966767935 17 Left 966767923 3:183479106-183479128 CCAGCCTCCCAGGGGGTGGCTCT No data
Right 966767935 3:183479146-183479168 CAGCATCATCCAGGGCACAGAGG No data
966767914_966767935 28 Left 966767914 3:183479095-183479117 CCAGGCCAACCCCAGCCTCCCAG No data
Right 966767935 3:183479146-183479168 CAGCATCATCCAGGGCACAGAGG No data
966767927_966767935 9 Left 966767927 3:183479114-183479136 CCAGGGGGTGGCTCTGTGGTCCC No data
Right 966767935 3:183479146-183479168 CAGCATCATCCAGGGCACAGAGG No data
966767921_966767935 19 Left 966767921 3:183479104-183479126 CCCCAGCCTCCCAGGGGGTGGCT No data
Right 966767935 3:183479146-183479168 CAGCATCATCCAGGGCACAGAGG No data
966767919_966767935 23 Left 966767919 3:183479100-183479122 CCAACCCCAGCCTCCCAGGGGGT No data
Right 966767935 3:183479146-183479168 CAGCATCATCCAGGGCACAGAGG No data
966767922_966767935 18 Left 966767922 3:183479105-183479127 CCCAGCCTCCCAGGGGGTGGCTC No data
Right 966767935 3:183479146-183479168 CAGCATCATCCAGGGCACAGAGG No data
966767926_966767935 10 Left 966767926 3:183479113-183479135 CCCAGGGGGTGGCTCTGTGGTCC No data
Right 966767935 3:183479146-183479168 CAGCATCATCCAGGGCACAGAGG No data
966767924_966767935 13 Left 966767924 3:183479110-183479132 CCTCCCAGGGGGTGGCTCTGTGG No data
Right 966767935 3:183479146-183479168 CAGCATCATCCAGGGCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966767935 Original CRISPR CAGCATCATCCAGGGCACAG AGG Intergenic
No off target data available for this crispr