ID: 966768710

View in Genome Browser
Species Human (GRCh38)
Location 3:183485057-183485079
Sequence AAAGCTTCTTTGACCCATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966768710_966768713 25 Left 966768710 3:183485057-183485079 CCTGTATGGGTCAAAGAAGCTTT 0: 1
1: 0
2: 0
3: 7
4: 75
Right 966768713 3:183485105-183485127 TTCAGCAGATTCTAGAAGAAGGG 0: 1
1: 0
2: 3
3: 34
4: 417
966768710_966768714 26 Left 966768710 3:183485057-183485079 CCTGTATGGGTCAAAGAAGCTTT 0: 1
1: 0
2: 0
3: 7
4: 75
Right 966768714 3:183485106-183485128 TCAGCAGATTCTAGAAGAAGGGG 0: 1
1: 0
2: 2
3: 47
4: 3769
966768710_966768712 24 Left 966768710 3:183485057-183485079 CCTGTATGGGTCAAAGAAGCTTT 0: 1
1: 0
2: 0
3: 7
4: 75
Right 966768712 3:183485104-183485126 CTTCAGCAGATTCTAGAAGAAGG 0: 1
1: 0
2: 1
3: 26
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966768710 Original CRISPR AAAGCTTCTTTGACCCATAC AGG (reversed) Intergenic
902626978 1:17682554-17682576 AAAGCTTCATTTACCAAAACTGG + Intronic
902653208 1:17850397-17850419 AAAGCTTCTCTGACCCTAATAGG - Intergenic
910502771 1:87912087-87912109 AAAGGTTCTTTTACCTATTCTGG + Intergenic
916740517 1:167643354-167643376 AAAGCCTCTTTGTCCTATATTGG - Intronic
920570618 1:207014208-207014230 AAAGCATCTTTGACTGATAAAGG + Intronic
922177140 1:223205436-223205458 AAAGTTTCATTGACCCAATCAGG - Intergenic
923210165 1:231796743-231796765 AAAGGTTCTTTCACCCAGGCTGG + Intronic
1071446304 10:85751307-85751329 AAAGCTTCTTAGAGCCAACCTGG - Intronic
1078582800 11:12551758-12551780 AAAGCATCTTTAACCCAGAAAGG - Intergenic
1080307578 11:30853407-30853429 AAAGCTCCTTTCACCCCTACAGG - Intronic
1087104841 11:94398907-94398929 TAAGCTGCTTTGGCTCATACTGG + Intronic
1087999360 11:104856797-104856819 AAAACTGCATTGCCCCATACAGG + Intergenic
1089805204 11:121081070-121081092 AAAGCTTCTTTCAACCTTAGGGG - Intronic
1097104255 12:56611725-56611747 AAAGTTTCTTGGAACCAGACAGG + Intronic
1103301747 12:119932952-119932974 AATCCTTCTTTGACCCCTCCAGG - Intergenic
1106677853 13:31980356-31980378 AATGCTTCTTTGACCACTTCTGG + Intergenic
1115155449 14:30333756-30333778 TGAGCTTTTTTGACCCATACAGG - Intergenic
1117827866 14:59722374-59722396 AAAGCTGCTGTCACCCATGCAGG - Intronic
1118982319 14:70726790-70726812 GAAGCTTCTTTCATCTATACAGG - Intronic
1202893058 14_KI270722v1_random:177656-177678 AAAGATTCTGTGAGGCATACAGG + Intergenic
1125294196 15:38184713-38184735 AAAAGTTCTTTGTCCTATACAGG + Intergenic
1133368258 16:5228307-5228329 GAAGCTTCTATGACAGATACCGG - Intergenic
1135481727 16:22826246-22826268 AAAGCCTCTTTGGCCCACCCTGG - Intronic
1138906827 16:61346462-61346484 AAAGTTTACTTAACCCATACTGG - Intergenic
1146375006 17:32287958-32287980 GAAGCTTCTCTGACACATACTGG - Intronic
1146458674 17:33026351-33026373 TCATCTTCTTTAACCCATACAGG + Intronic
1149324091 17:55512107-55512129 GAAGCTTTTTTGACCCACACTGG - Intergenic
1150942181 17:69704705-69704727 AAACCTTCTTTGACCTTTCCAGG + Intergenic
1159293759 18:66454669-66454691 AACCCTTCCTTGACCCATAATGG - Intergenic
1161648018 19:5466311-5466333 AGAGCTTCACTGACCAATACGGG + Intergenic
1166933472 19:46316431-46316453 AAAGCTTCTATGACACATGATGG - Intronic
928989621 2:37218840-37218862 GAAGGTTCTGTCACCCATACTGG - Intronic
930826633 2:55702165-55702187 AATTCTTCTTTGACCAACACTGG + Intergenic
932007205 2:67939009-67939031 AAAGCCTTTTTTACCCACACTGG + Intergenic
933247088 2:79987534-79987556 AAAACTACTTTGACACATACTGG + Intronic
937382845 2:121396572-121396594 AAAGCTAGTTTGTCCCAAACAGG + Intronic
939347956 2:140992348-140992370 AATGCTTCTTCTACCCATAGAGG + Intronic
944784710 2:203057408-203057430 AAAGCTTATATGATCCATATCGG + Exonic
947043895 2:225955124-225955146 AAAGCTTTTATGACCCAGAATGG + Intergenic
1173041163 20:39464308-39464330 AAAGCTGCTTCTCCCCATACAGG - Intergenic
1177713511 21:24810309-24810331 AATGCTTCTTTGAAGCAAACTGG + Intergenic
1177717537 21:24858724-24858746 AAAGGTTTTTTGACCCATATGGG + Intergenic
1178109796 21:29358394-29358416 AAAGCATGTTTAACCCACACAGG - Intronic
1184084668 22:42253351-42253373 AAAGCTTCTTCAACAGATACAGG + Intronic
950169079 3:10824063-10824085 AAAGGATCTGTGACCCTTACAGG + Intronic
950876555 3:16280001-16280023 AAATCTGCTTTGCCCCTTACTGG + Intronic
957926421 3:86819132-86819154 AAATCTTCTTGGCTCCATACAGG - Intergenic
959571683 3:107891373-107891395 AAAGATTCTTAGTCCCAAACAGG + Intergenic
964533597 3:157695255-157695277 AAAGCATCTCTGACACAGACAGG - Intergenic
966383168 3:179364003-179364025 AAATCATCTCTGAGCCATACTGG + Intronic
966768710 3:183485057-183485079 AAAGCTTCTTTGACCCATACAGG - Intergenic
979164829 4:117515846-117515868 AAAGCTTCTTTTTGCCTTACTGG - Intergenic
980583006 4:134777062-134777084 ACAGCTTCTTTGATCCACCCTGG + Intergenic
986648357 5:9940239-9940261 AAATCTTCCTTGACCCCTTCAGG - Intergenic
987204543 5:15611429-15611451 AAAGCTTATCTGACACATATTGG - Intronic
988367279 5:30317012-30317034 TAATTTTCTATGACCCATACTGG - Intergenic
989115487 5:37948633-37948655 TAAGCTTCTTTTCCCCAAACCGG + Intergenic
993692937 5:91025045-91025067 CAAGCTTCTCTGACCAACACTGG + Intronic
1003452786 6:6251612-6251634 AAAGCATCTTTAACACAGACAGG + Intronic
1003486799 6:6587120-6587142 AAAGCTTCTGTGTTCCATCCTGG + Intergenic
1004853912 6:19729742-19729764 CAAGCTTCTTAGACTAATACTGG - Intergenic
1005605883 6:27477071-27477093 AAAGATTCTCTCACCCCTACAGG - Intergenic
1010103187 6:72134860-72134882 AAAACATCTGTGACCCTTACTGG - Intronic
1011636168 6:89375747-89375769 AAACCATCTGTGACCCAGACTGG + Intronic
1011942741 6:92863107-92863129 AAAGGTTCCTTGGCCCACACCGG + Intergenic
1012748377 6:103123550-103123572 AATGCTTCCTTGTCCCAGACAGG - Intergenic
1014406115 6:121053212-121053234 TAAGCTTCCTTCAACCATACTGG + Intergenic
1017502099 6:155035035-155035057 AAAGCTTCGTGGACCCATATAGG - Intronic
1019728091 7:2613936-2613958 AAAGCTACTTTGTCCAACACCGG - Exonic
1029920281 7:104255094-104255116 AAAGCTTCGTTGACAAAAACAGG - Intergenic
1032142786 7:129348793-129348815 AAAGGTTCATTGATCCATTCAGG - Intronic
1032831143 7:135627657-135627679 AAAGCTTCCTTGGGCCATATAGG - Intronic
1034166205 7:149027062-149027084 AAAGCATCTTCCACCCACACTGG + Intronic
1040093042 8:43418444-43418466 AAGGCTTTTCTGACCCATAAGGG + Intergenic
1046604812 8:116359652-116359674 AAATCTTCCTTGAGCCGTACTGG + Intergenic
1047772130 8:128038059-128038081 CAAGCTTCTTTGTTCGATACTGG - Intergenic
1052549638 9:29931555-29931577 AAAGTTTCTTTGACGTATTCAGG - Intergenic
1203490261 Un_GL000224v1:98031-98053 AAAGATTCTGTGAGGCATACTGG + Intergenic
1203502884 Un_KI270741v1:39914-39936 AAAGATTCTGTGAGGCATACTGG + Intergenic
1188367146 X:29330619-29330641 ACAGTTTCCTTGACCCAGACAGG + Intronic
1189620501 X:42832096-42832118 AAGACTTCTCTGACCCATTCTGG + Intergenic
1195522478 X:105847256-105847278 AAAGTCTCTTTGACACAGACTGG - Intronic
1199585920 X:149415587-149415609 ACAGCTCCTTTAACCCCTACTGG - Intergenic