ID: 966769892

View in Genome Browser
Species Human (GRCh38)
Location 3:183494375-183494397
Sequence CCAGGCCAGCCCTACCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 369}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966769880_966769892 13 Left 966769880 3:183494339-183494361 CCCATAATATCCCACATGTCCAA 0: 1
1: 0
2: 3
3: 9
4: 194
Right 966769892 3:183494375-183494397 CCAGGCCAGCCCTACCCTGAGGG 0: 1
1: 0
2: 3
3: 27
4: 369
966769886_966769892 -6 Left 966769886 3:183494358-183494380 CCAAAAGTGCCAGGTCCCCAGGC 0: 1
1: 0
2: 8
3: 113
4: 2376
Right 966769892 3:183494375-183494397 CCAGGCCAGCCCTACCCTGAGGG 0: 1
1: 0
2: 3
3: 27
4: 369
966769882_966769892 3 Left 966769882 3:183494349-183494371 CCCACATGTCCAAAAGTGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 248
Right 966769892 3:183494375-183494397 CCAGGCCAGCCCTACCCTGAGGG 0: 1
1: 0
2: 3
3: 27
4: 369
966769881_966769892 12 Left 966769881 3:183494340-183494362 CCATAATATCCCACATGTCCAAA 0: 1
1: 0
2: 0
3: 18
4: 174
Right 966769892 3:183494375-183494397 CCAGGCCAGCCCTACCCTGAGGG 0: 1
1: 0
2: 3
3: 27
4: 369
966769884_966769892 2 Left 966769884 3:183494350-183494372 CCACATGTCCAAAAGTGCCAGGT 0: 1
1: 0
2: 0
3: 14
4: 166
Right 966769892 3:183494375-183494397 CCAGGCCAGCCCTACCCTGAGGG 0: 1
1: 0
2: 3
3: 27
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966769892 Original CRISPR CCAGGCCAGCCCTACCCTGA GGG Intronic
900529993 1:3148414-3148436 CCAGCCCAGCCCAGCCCTGCCGG - Intronic
900568948 1:3348960-3348982 CCAGGCCAGCGCTGCCCCGGTGG - Intronic
900624548 1:3602284-3602306 CCATGGCAGACCCACCCTGAGGG + Intronic
900624972 1:3603835-3603857 CCAGGCCAGCCGCCCCCAGATGG + Intronic
900672772 1:3866078-3866100 ACAGGCCAGCCCTTCACTGGGGG - Intronic
900718101 1:4157940-4157962 CCAGGCCATCCCTGCCCTCCTGG - Intergenic
900743120 1:4342548-4342570 CCAGCCCAGCCCTCCCCTCTCGG - Intergenic
901539520 1:9906672-9906694 ACAGGGCAGCCCTTCCTTGATGG - Intronic
902590657 1:17472008-17472030 CCAGACCAGCCTGACCATGATGG + Intergenic
903234181 1:21938758-21938780 CCAGGGCAGCCCGAGGCTGATGG + Intergenic
903357417 1:22756528-22756550 CCAGGCCTGCTCAACCCAGACGG - Intronic
903374078 1:22854818-22854840 CCAGCCCAGCCCAGCCCAGAGGG + Intronic
903663948 1:24995560-24995582 ACAGTCCAGCTCTGCCCTGAAGG + Intergenic
903849394 1:26297044-26297066 CCAGGTCACCTCTGCCCTGAGGG + Intronic
904418395 1:30376278-30376300 CCAGGCCAGCCCAGTCCTCATGG - Intergenic
905181673 1:36171135-36171157 CTAGGCCCGACCTGCCCTGAGGG - Exonic
905790121 1:40785053-40785075 CCTGCCCTGCCCTACCCTGCCGG + Intronic
907516961 1:54998916-54998938 CCAGGCCAGCCGGGCCCAGAGGG + Exonic
907648132 1:56264691-56264713 CCAGGCCTGCCTTGCCCAGATGG - Intergenic
908093035 1:60706755-60706777 CCAGACTAGCCCTAGCCAGAGGG + Intergenic
915309643 1:155000764-155000786 CCAGGCCTGCACGACCCAGACGG + Intergenic
915827129 1:159089956-159089978 CCAGGACTGCCCTATGCTGAAGG + Intronic
916820118 1:168389936-168389958 CCAAGGCAGCCCAAACCTGAGGG - Intergenic
917300754 1:173571387-173571409 CCAGGCTGGCCCTTCCCTTAGGG + Intronic
917816526 1:178715301-178715323 CCACGCCACCCCCACCCTAAAGG - Intergenic
917967502 1:180187753-180187775 CACTGCCAGCCCTACCCCGAGGG - Intronic
919785147 1:201254040-201254062 CCAGCCCAGCCCAGCCCTGCAGG + Intergenic
919843958 1:201629258-201629280 CAGGGCCAGCCCCTCCCTGATGG - Intronic
919866515 1:201787057-201787079 CCAGGCCATCCTAACGCTGAAGG + Intronic
919916731 1:202143977-202143999 CAAGCCCAGCCCCACCCAGAGGG - Intronic
920977748 1:210801609-210801631 CCCAGCCAGCCCTACAGTGAGGG + Intronic
921065952 1:211621983-211622005 CCAGTCCAGCCCTCCCCAGTGGG + Intergenic
921277216 1:213532233-213532255 CCAAGGCAGCCCCATCCTGAAGG + Intergenic
921829571 1:219711833-219711855 ACAGGTCAGCCCTATCCTCAAGG + Intronic
921872186 1:220152977-220152999 CCAGGCCTGCCCTACGCACAGGG - Intronic
923076019 1:230609202-230609224 CCAGGCCAAGCCTACACTAAGGG + Intergenic
923850841 1:237792604-237792626 CCAGGCCAGGACAGCCCTGAAGG - Intronic
924567299 1:245209602-245209624 CCAGGCCAGCCTTTCCATGAAGG - Intronic
1066382337 10:34912143-34912165 CCAGGCCTGCCCCAGCCAGAAGG + Intergenic
1067070222 10:43125700-43125722 CCAGCACAGCCCTGCCCTCACGG + Intronic
1067180530 10:43982493-43982515 CAGGGCCTGCCCAACCCTGATGG + Intergenic
1067429881 10:46236045-46236067 CCAGGCCAGTCTCAGCCTGATGG + Intergenic
1067443759 10:46327774-46327796 CCAGGCCAGTCTCAGCCTGATGG - Intronic
1067539793 10:47143235-47143257 CCAGCCCAGCCGTAGCCCGAGGG - Intergenic
1071630262 10:87214004-87214026 CCAGGCCAGCCCGAGCCAGGAGG - Intergenic
1075635225 10:124026129-124026151 CCAGTCCTCCCCTACCCTCAGGG - Intronic
1075638877 10:124050208-124050230 CCAGACAAGACCTCCCCTGACGG + Intronic
1075734667 10:124656597-124656619 CCAGGCCAGCCCAGCCCCTAAGG + Intronic
1076735234 10:132456014-132456036 CCAGGCCAGCCCCTCTCTGTAGG + Intergenic
1076919934 10:133446176-133446198 CCGGGCCAGCCCTGCCCTGGCGG + Intergenic
1077551103 11:3200670-3200692 TCAGCCCTGCCCTACCCTCAAGG - Intergenic
1077583885 11:3435612-3435634 CCAGGCTAGCCCTGCCCTACAGG - Intergenic
1078132579 11:8624919-8624941 CCAGGCTTGCCATAGCCTGAGGG + Exonic
1080204446 11:29712878-29712900 CCAGCCCTGCCCTGCCCTGCAGG - Intergenic
1080596000 11:33774606-33774628 CCGGGCCAGCCCCGCCCTCAGGG + Intergenic
1081618254 11:44603241-44603263 CCTGGCCAACCCTACTCTCAAGG - Intronic
1081887542 11:46511780-46511802 CAAGGCCTGCCCTTCACTGATGG - Intronic
1082825922 11:57578797-57578819 CCAGCCAAGCTCTGCCCTGAGGG - Intergenic
1083127866 11:60590809-60590831 CCAGGCCAACCCTAAGCTGCAGG + Intergenic
1083334243 11:61913530-61913552 CCAGTCCAGCCCACCCCTGGCGG + Intronic
1083897005 11:65625009-65625031 GCAAGCCACCCCTACCTTGATGG - Exonic
1083962068 11:66020234-66020256 CCAGGCCTGCTCAACCCTGGAGG + Intronic
1084008819 11:66336592-66336614 CCATGCTAGCCCTGCTCTGAGGG + Intronic
1085302615 11:75467354-75467376 TCAGGCCATCCCTGCCCTGAGGG - Intronic
1085413687 11:76306635-76306657 CCAGGCCAGGCCTGGCATGAAGG - Intergenic
1088905851 11:114155205-114155227 CCACGCCTGCCCTGTCCTGAGGG + Intronic
1088911159 11:114193453-114193475 CTTTGCCAGCCCTATCCTGAGGG - Intronic
1089181609 11:116587114-116587136 TCAGGCCAGCCATACCAAGAAGG + Intergenic
1089261276 11:117225562-117225584 CCAGCACAGCCATGCCCTGAAGG + Intronic
1089493689 11:118898328-118898350 CCAGGCCATCCCAACATTGAGGG + Exonic
1089608093 11:119653454-119653476 CCAACCCAGCCCTGCCCTGAGGG + Intronic
1090184170 11:124725445-124725467 CCAGGCCTGCCCTGCCAGGAAGG + Intergenic
1091658085 12:2360347-2360369 CCAGGCCACACCTGCCCTGGTGG + Intronic
1091980163 12:4858243-4858265 CCAGCCCAGCCCTCCCTTGCTGG - Intergenic
1092400271 12:8169987-8170009 CCAGACCAGCCCTACCAAAATGG + Intronic
1092562801 12:9633983-9634005 CCAGGTGAGACCTACACTGATGG - Intergenic
1093243217 12:16703289-16703311 CTAGACCAGCCCCACCCTTAAGG - Intergenic
1094447345 12:30546137-30546159 CCAGCCCTGCCCTCACCTGATGG - Intergenic
1095625008 12:44304298-44304320 CTAGACCAGCCCTAGCCAGAGGG + Intronic
1096226449 12:49869546-49869568 CCAGGCCAGCCCCATCTGGAAGG - Exonic
1096803380 12:54126296-54126318 CCGGGCCCGCCCGGCCCTGATGG + Intergenic
1096975016 12:55694860-55694882 CCAGCCCAGCCCCAGGCTGATGG - Exonic
1097173430 12:57129486-57129508 CCAGGCCAGGGGTACCCTGCCGG + Intronic
1097536162 12:60873052-60873074 TCAGGCCATCCCTGGCCTGAAGG + Intergenic
1097679374 12:62634177-62634199 CCAGGCCAGTACCATCCTGAGGG - Intergenic
1099377544 12:81910531-81910553 CAAGGCCAGTATTACCCTGATGG - Intergenic
1101873390 12:108583058-108583080 CCAGACCAGCCCTAGCCTCTGGG + Intergenic
1101962041 12:109258041-109258063 CCATCCCAGCCCTCCTCTGATGG + Intronic
1102151083 12:110689337-110689359 CCAGGACAGGCCCACCCTGCGGG - Intronic
1102413912 12:112743963-112743985 CCAGGCCAGTGCTACACTGTGGG - Intronic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1104804772 12:131578645-131578667 CCAGCCCAGCCCTCCCGTGCTGG - Intergenic
1105604462 13:21915343-21915365 CCTGGCCATCCCTCCCCTGCTGG + Intergenic
1105819833 13:24070370-24070392 GGGGGCCATCCCTACCCTGAGGG - Intronic
1106164500 13:27231045-27231067 CAAGGCCAGCCATACCTTGTGGG + Intergenic
1106219483 13:27733834-27733856 CCAGGGTGGCCCTACCCTCAGGG - Intergenic
1106592666 13:31110766-31110788 CCCGGCCAGCTCTGCCCTGTGGG - Intergenic
1107524306 13:41214599-41214621 CTAGACCAGCCCTAGCCAGAGGG - Intergenic
1107699831 13:43036582-43036604 TCAGGCCAGTCCTAGCTTGAAGG + Intronic
1108601480 13:51998923-51998945 CCAGGCCATCCCTCCCAAGATGG + Intronic
1111202843 13:84962104-84962126 TCAGGCCGGCCCTGGCCTGAAGG + Intergenic
1112398653 13:99056798-99056820 CCAGGACAGGCCTTCCCTGGAGG + Intronic
1112443163 13:99439796-99439818 CCAGAGCAGCCCTTCCGTGATGG + Intergenic
1113229301 13:108195015-108195037 TCAGGCCATCCCTGGCCTGAAGG - Intergenic
1113339141 13:109404762-109404784 TCAGGCCCTCCCTAGCCTGAAGG - Intergenic
1113358459 13:109605771-109605793 TCAGGCCAGCCACAGCCTGATGG - Intergenic
1113777468 13:112956113-112956135 CCAGGCCAGCCCTACAAGCACGG - Intronic
1113868753 13:113545631-113545653 CCAGGGCAGCCCTGCCTTGAAGG + Intronic
1113868768 13:113545696-113545718 CCAGGGCAGCCCTGCCTTGAAGG + Intronic
1113941830 13:114022445-114022467 CGTGGCCAGCCCTACCCAGGGGG + Intronic
1114537369 14:23431632-23431654 CCAGGCCAACCCTGCTCTGGAGG - Exonic
1114633967 14:24177233-24177255 CCAGGCGGGCCCTACGCTGCCGG - Intronic
1115535485 14:34369163-34369185 CCAGGAGAGCCCTACCATCATGG - Intronic
1117758708 14:59003722-59003744 CCAGGCCAGCTCTCTCCTGTGGG - Intergenic
1118213547 14:63787834-63787856 TCAGGCCCTCCCTGCCCTGAAGG + Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1122736791 14:103847868-103847890 CCGGGCCGGCCCTTCCCTGTCGG - Intergenic
1122847947 14:104510946-104510968 CCACGGCAGCCCTTCCCAGACGG - Intronic
1123475879 15:20592404-20592426 CCAGGCCAGCCCTTGCCTTCTGG + Intergenic
1123642132 15:22407959-22407981 CCAGGCCAGCCCTTGCCTTCTGG - Intergenic
1124670464 15:31634213-31634235 GAAGTCCAGCCCTGCCCTGACGG - Intronic
1125512312 15:40298690-40298712 CCAGGCCAGCTGTCACCTGAAGG - Exonic
1125723573 15:41856822-41856844 CGAGGCCAGCCCTCCCCGGGTGG + Intronic
1126106913 15:45152625-45152647 CCAGGCCAACTCCATCCTGATGG - Intronic
1126109324 15:45166671-45166693 CCAGGCCCGCCCCACCCCGCGGG - Intergenic
1126777599 15:52112785-52112807 GCACGGCAGCCCTACCCTGGGGG - Intergenic
1126881701 15:53105894-53105916 CTAGGCAAGCTCTACCCTGTTGG - Intergenic
1127766922 15:62195398-62195420 CCAGCCCAGCCCTGCCCCGGGGG + Intergenic
1127816254 15:62611649-62611671 CCAGGCCCTCACTACCCAGAGGG + Intronic
1128454401 15:67824547-67824569 CCAGGGCAGCCCAACCCTGAGGG - Intronic
1129030737 15:72615907-72615929 TTAGACCAGCCCTACCCAGAGGG - Intergenic
1129198246 15:73983637-73983659 CCAGGCCTGCCCTGCCCTGCTGG - Exonic
1129477582 15:75796431-75796453 TTAGACCAGCCCTACCCAGAGGG - Intergenic
1129835647 15:78703708-78703730 TTAGACCAGCCCTACCCAGAGGG - Intronic
1129858292 15:78840810-78840832 CCAGTCCTGCCCTGCCCTGCTGG + Intronic
1132289892 15:100692595-100692617 CCAGGCCAGCCCCAGCTTGCTGG - Intergenic
1132353411 15:101154563-101154585 CCCACCCAGCCCAACCCTGATGG - Intergenic
1132833722 16:1942398-1942420 CCAGGCGAGCCCAGCCCAGAAGG + Intronic
1134126116 16:11617325-11617347 CCTGGGCAGCCTTACCCTGGGGG - Intronic
1134241274 16:12508818-12508840 CCAGCCATGTCCTACCCTGAGGG + Intronic
1135299625 16:21314340-21314362 CCACGTCACCCCTACCATGAGGG + Intergenic
1136294433 16:29293555-29293577 CCAGGCCAGCCTGCCCCAGAGGG - Intergenic
1136682800 16:31977815-31977837 CCAGGGCAGCCCTGCCCTCCTGG + Intergenic
1136783438 16:32921381-32921403 CCAGGGCAGCCCTGCCCTCCTGG + Intergenic
1136886349 16:33932468-33932490 CCAGGGCAGCCCTGCCCTCCTGG - Intergenic
1138123810 16:54422487-54422509 GCAGGCCAGCCCTGCCCCGATGG - Intergenic
1138317321 16:56081422-56081444 TCTGGGCAGCCCCACCCTGAGGG + Intergenic
1138654351 16:58482142-58482164 CCTAGCCAGCTCTACCCTGGGGG - Intronic
1139465351 16:67151115-67151137 CCAGACCAGCCCTTCCCAGAGGG - Exonic
1141034953 16:80618693-80618715 CCAGGCCAGCCCTGGGTTGACGG - Intronic
1141834862 16:86532029-86532051 CCTGGCCAGCGCCACCCTCAGGG + Exonic
1141860564 16:86713459-86713481 CCAAGCCAGCCCCATCCTGCTGG + Intergenic
1141868251 16:86765889-86765911 CCAGGGCATCCCTACCCTCAGGG - Intergenic
1141953609 16:87355043-87355065 CCAGGACAGTCCTACACTCAGGG + Intronic
1142100335 16:88267599-88267621 CCAGGCCAGCCTGCCCCAGAGGG - Intergenic
1203086089 16_KI270728v1_random:1185365-1185387 CCAGGGCAGCCCTGCCCTCCTGG + Intergenic
1142639813 17:1279425-1279447 CCAGCCCAGCCCAGCCCAGAGGG - Intergenic
1142872147 17:2827942-2827964 TCCGGCCAGCCCTTCCCTGTGGG + Intronic
1142885960 17:2912218-2912240 CCAGCCCAGCTCTGCCCAGAGGG - Intronic
1143014472 17:3884265-3884287 CCAGGCAAGTCCTAGCCTGGAGG - Intronic
1144647182 17:16983090-16983112 CCAGGCCAGCCCAGCCATTAGGG - Intergenic
1144664160 17:17090862-17090884 CCAGACACGCCCTAGCCTGAAGG + Intronic
1146657878 17:34645670-34645692 CCAGCCCACCCCTCCCCTGGTGG + Intergenic
1146673306 17:34756680-34756702 CAGGGCCAGGCCAACCCTGAGGG + Intergenic
1146937791 17:36823503-36823525 CCAGCCTGGCCCTACCCTGGTGG + Intergenic
1147143707 17:38473574-38473596 CCAGGGCAGCCCTGCCCTCCTGG + Intronic
1147302000 17:39537032-39537054 CCAGGCCAAACCAACCCTGAGGG + Intronic
1149633260 17:58143617-58143639 CCTCACCATCCCTACCCTGATGG + Intergenic
1149656584 17:58312388-58312410 CCAGGCCAGCACCACGCTGTGGG + Exonic
1150221728 17:63499429-63499451 CCTGGCCAGCCTTACCCTCTGGG + Intronic
1150442294 17:65201333-65201355 CCTGGCCAGACCTTCCCTGAGGG + Intronic
1151548570 17:74808186-74808208 CCAGCCCAGTCCTGCCCTGAAGG + Intronic
1151829666 17:76542232-76542254 CCAGGCCAGGCCTGGCCAGATGG - Intronic
1151879442 17:76886324-76886346 CCAGGTCTGCCCCACTCTGAGGG - Intronic
1152102169 17:78308400-78308422 CCAGGCGAGTCCTTCCCGGAAGG + Intergenic
1152107921 17:78341793-78341815 CCGGGGCAGCCCTGCCCGGAAGG - Intergenic
1152199316 17:78935913-78935935 CCAGACCACCCCAACCCTGCTGG - Intergenic
1152278480 17:79371795-79371817 CCTGGTCAGCCGTGCCCTGAGGG + Intronic
1152510267 17:80782076-80782098 ACAGGCCAGCGATACCCTGGGGG - Intronic
1152596251 17:81239118-81239140 CAGGGCCCGCCCTACCGTGAGGG - Intergenic
1154193744 18:12251467-12251489 CCAGGCCGGCCCTTCCCTCATGG + Intergenic
1154987748 18:21569543-21569565 CCAGGCCAGCCTCACCAAGATGG + Intronic
1157499089 18:48177641-48177663 ACAGGCCAGGCCTGGCCTGAGGG - Intronic
1157515602 18:48308945-48308967 CCAGCCCAGCCTCACCCTGAGGG - Intronic
1159446207 18:68544639-68544661 TCAGACCAGCCCTAGCCAGAAGG + Intergenic
1161249935 19:3275241-3275263 CCAGCCCAGCCCCACCCAGCAGG + Intronic
1162410644 19:10503123-10503145 CCCGGCCATCCCCACCCCGAGGG - Intronic
1163105476 19:15120642-15120664 CCTGCCCAGCCCTCCCCTCAGGG + Intronic
1164643690 19:29843719-29843741 CCAGGCCAGGCCGGCCCTGAGGG + Intergenic
1164983485 19:32631307-32631329 CCATGCCTGGCCAACCCTGATGG + Intronic
1165900550 19:39167443-39167465 CCAGCCCAGCCCACCCCTGGTGG - Intronic
1166410830 19:42554583-42554605 CCAGGTCAGCCCTGACCTGTGGG - Intronic
1167301693 19:48681444-48681466 CGAAGCCATCCCTGCCCTGAAGG + Intergenic
1167380809 19:49136929-49136951 CCCGGCCTGCCCTGCCCTGCCGG + Intronic
925829751 2:7882573-7882595 CTAGGACATCCCTAGCCTGAAGG + Intergenic
926220920 2:10934940-10934962 CCCAGCCAGCCCTGCCCTCAGGG - Intergenic
926320305 2:11744727-11744749 CCAGGCCAGCTCCTCCCTGGAGG + Intronic
927533868 2:23836960-23836982 TCAGGCCCTCCCTAGCCTGAAGG + Intronic
927964567 2:27261330-27261352 CCAGGCCAGAGCTTCCCTGGAGG + Intronic
928084770 2:28339138-28339160 CCAGGCCAGCCCCACACAGTAGG + Intergenic
929798925 2:45082871-45082893 AGAGCCCAGCCCTGCCCTGAGGG + Intergenic
929892002 2:45925913-45925935 CCAGGCCAGGGATAACCTGAGGG + Intronic
931600964 2:64002042-64002064 TCAGACCAGCCCTAGCCAGAGGG - Intronic
932570704 2:72936946-72936968 CATGGCCAGCCCTTCCCTGAGGG + Intergenic
934689181 2:96345287-96345309 CCAGCCAAGCCCTTCCCTGGAGG - Intronic
936156212 2:110048966-110048988 CCAGGCCAGCCCTCCCTCCAGGG - Intergenic
936188476 2:110322462-110322484 CCAGGCCAGCCCTCCCTCCAGGG + Intergenic
936511391 2:113150299-113150321 CTAGACCAGCCCTAGCCAGAGGG - Intergenic
937201074 2:120204862-120204884 CCAGCGCAGCCCAACCCTCAAGG + Intergenic
938778174 2:134560110-134560132 CCAGGACAGCCCTAACCTGAAGG - Intronic
941740239 2:169028238-169028260 TCCAGCCAGCCCTACCCTCATGG + Intronic
943067724 2:183106144-183106166 CTAGACCAGCCCTAGCCAGATGG + Intergenic
944147294 2:196519581-196519603 TCAGGCCAGTCCACCCCTGAAGG + Intronic
944287331 2:197966450-197966472 TCAGGCCAGCCCTAGCCAAAAGG - Intronic
944673895 2:202019198-202019220 CCAGGCCAGACATACACAGATGG + Intergenic
944990631 2:205230828-205230850 TCAGACCAGCCCTAGCCAGAGGG - Intronic
945297036 2:208180730-208180752 CCAGGTCACCCTTACCTTGATGG + Exonic
946174389 2:217913560-217913582 CCAGCTCAGCCCTCCCCTGGCGG + Intronic
946366158 2:219250414-219250436 CCAGGGCAGCCATATCCTCACGG + Exonic
947023560 2:225711352-225711374 CCTAACCAGCCCCACCCTGAGGG - Intergenic
948795335 2:240399617-240399639 CCAGGCTGGTCCTGCCCTGAGGG + Intergenic
1172530176 20:35625639-35625661 CCAGCCCAGCTCTGCCCTGAGGG + Intergenic
1172774494 20:37399101-37399123 CTGGGCCAGCCCCACCGTGAGGG - Intronic
1172984026 20:38968071-38968093 AGATGCCAGCCCTACCCTCACGG - Intronic
1176024768 20:62980166-62980188 CCAGCCCTGCCCAACCCTGCCGG + Intergenic
1177276075 21:18914089-18914111 GCAGCCCAGCCCTAGCCAGAGGG - Intergenic
1177427723 21:20946910-20946932 ACAGTCCAGACCTTCCCTGAAGG + Intergenic
1178426772 21:32484891-32484913 ACAGGCCAGCCCCTCCCTGTGGG - Intronic
1178753644 21:35327343-35327365 CCAGGTCAGCCCAGACCTGATGG - Intronic
1179349611 21:40595542-40595564 CCAGCCAAGCTCTGCCCTGAAGG + Intronic
1179788805 21:43743846-43743868 CCAGGCCAGCCCCACCCGTGTGG - Intronic
1179926518 21:44538084-44538106 CCAGGCCGGCCGCAGCCTGATGG - Intronic
1180178951 21:46109455-46109477 TCAGGCCTGCCCCAGCCTGAAGG + Intronic
1180220608 21:46355850-46355872 CCAGGTCAGACCTGCCCTGCTGG - Intronic
1180834291 22:18922136-18922158 CCAGCCCAGCCCCAGCCTCAGGG + Intronic
1181040958 22:20192450-20192472 CCAGGACGGCCTTACCCAGATGG + Intergenic
1181051824 22:20241586-20241608 CCAGGCCAGGTCCTCCCTGATGG - Exonic
1181065519 22:20303967-20303989 CCAGCCCAGCCCCAGCCTCAGGG - Intergenic
1181165776 22:20982270-20982292 CCCGGCGAGCCCTGCGCTGACGG - Exonic
1181627744 22:24133088-24133110 CCCTGCCTGCCCCACCCTGAGGG - Intronic
1182778989 22:32852385-32852407 CAAGTCCAGCCCTACACTGCTGG - Intronic
1182958872 22:34453309-34453331 TCAGGCCAGCCCTGCTCTGCAGG - Intergenic
1183258099 22:36776016-36776038 TCAGCACAGCCCTACCCAGAGGG + Exonic
1183770237 22:39918408-39918430 TCAGGCAAGCCCTCTCCTGATGG - Intronic
1184074595 22:42168346-42168368 CCTGGCCAGCTGTGCCCTGAAGG + Intronic
1184336312 22:43855215-43855237 CTAGGCCAGCCCAACTCTGCAGG - Intronic
1184650843 22:45918900-45918922 CCTGGCCACCCCTGCCCTGCAGG - Intergenic
1184962985 22:47945078-47945100 CCTGCCCCGCCCTCCCCTGAGGG - Intergenic
1185329915 22:50247871-50247893 CCAGGCCAGCCCTGCCCACCTGG + Exonic
1203284380 22_KI270734v1_random:147435-147457 CCAGCCCAGCCCCAGCCTCAGGG + Intergenic
950659824 3:14460403-14460425 CCAGGCAAGACCTACCAAGAAGG + Intronic
950781720 3:15398143-15398165 CCAGGCCAGCCATGCCATGTGGG - Intronic
951508902 3:23480008-23480030 TCAGGCCATCCCCAGCCTGAAGG + Intronic
952676474 3:36037264-36037286 TTAGGCCAGCATTACCCTGACGG - Intergenic
952857604 3:37785093-37785115 CCAGGACAGCCCTCCTCAGAGGG + Intronic
953017187 3:39088705-39088727 CCAGTCCAGCCCTTCCCTGAAGG - Intronic
954164756 3:48747855-48747877 TCAGGCAAGCCCTGCACTGACGG - Exonic
954630404 3:52044916-52044938 CCAGGACAGCACAGCCCTGACGG - Intergenic
954715334 3:52524010-52524032 CCAACCCAGCCCTACCTGGAAGG - Exonic
954792008 3:53140224-53140246 CCAGGCCTGGCCTTCTCTGATGG - Intergenic
957297085 3:78346146-78346168 CCAGGCCCTCCCAATCCTGAAGG - Intergenic
957465272 3:80581549-80581571 CCAGGCCCTCCCAATCCTGAAGG - Intergenic
958195304 3:90235674-90235696 CCAGGCCTTCCCCAGCCTGAAGG - Intergenic
959186009 3:103049143-103049165 CCAGGCAAGGCCGACCCTGGAGG - Intergenic
959409138 3:105998289-105998311 CTAGACCAGCCCTAGCCAGAGGG - Intergenic
961448686 3:126992688-126992710 CCAGGGCACCCCCACCCTGGGGG - Intronic
961575947 3:127836659-127836681 CTGGGCCAGCCCTAGGCTGAGGG - Intergenic
961603990 3:128080000-128080022 CCAGGCCTGTCCTTCCCTGCTGG - Intronic
961608051 3:128112348-128112370 CCAGGCCTTCCCTCCTCTGAGGG - Intronic
962105250 3:132382963-132382985 TCAGGCCCTCCCTAGCCTGAAGG + Intergenic
962688448 3:137869346-137869368 CCAGGACCTCGCTACCCTGAAGG + Intergenic
963119565 3:141764683-141764705 CCAGCCCAGCCCTCTCCTGTGGG + Intergenic
964248620 3:154684338-154684360 CTAGTCCAGCCCCAACCTGATGG - Intergenic
965223547 3:165958694-165958716 CCAAGCCAGCCATACCTTGAAGG - Intergenic
965452349 3:168853644-168853666 CAAGACCAGCATTACCCTGATGG - Intergenic
965867123 3:173217495-173217517 TTAGGCCAGCCCTAGCCAGAGGG - Intergenic
966769892 3:183494375-183494397 CCAGGCCAGCCCTACCCTGAGGG + Intronic
968472341 4:787874-787896 CCAGGCCAGCCCAACCCCACTGG - Intronic
968933569 4:3597433-3597455 CCAGGCCTTCCCGACCCTGTTGG - Intergenic
968935771 4:3609608-3609630 GCTGCCCAGCCCTACCCTGGGGG + Intergenic
969325479 4:6441552-6441574 CCTGGACAGCCCTTCCCTGGCGG + Intronic
972404751 4:38735033-38735055 CCAAGGCAGCCCTAGCCAGATGG + Intergenic
975913662 4:79297851-79297873 TCAGGCCCTCCCTAGCCTGAAGG - Intronic
976675497 4:87697888-87697910 TCAGGCCCTCCCTAGCCTGAAGG + Intergenic
977816246 4:101416882-101416904 TCAGGCCATCCCTGTCCTGAAGG + Intronic
978686732 4:111454326-111454348 CCATTCCAGCCAAACCCTGAAGG - Intergenic
979448213 4:120839671-120839693 TCAGGCAATCCCTAGCCTGAAGG + Intronic
982918890 4:161249754-161249776 TCAGGCCATCCCTGCCTTGAAGG + Intergenic
982987481 4:162229719-162229741 CCATGCCATCCCTACATTGAGGG - Intergenic
983125878 4:163950093-163950115 ACAGGCCAGGCCCAGCCTGAAGG + Intronic
984469830 4:180154492-180154514 CCTGGCCAGCCATACTCTTATGG - Intergenic
984811167 4:183797574-183797596 CGCGGCCAGCCCTGCCCTGGGGG + Intergenic
985491040 5:179624-179646 CCAGGCCAGCTATGCTCTGACGG + Intronic
985780042 5:1865718-1865740 GCAGGCCAGCCCGGCCCTCAGGG + Intergenic
986046541 5:4043856-4043878 TCTGGCCAGCCCTACCCAGAGGG + Intergenic
986286196 5:6360842-6360864 CCAGGCCATCCTCATCCTGAAGG + Intergenic
986661011 5:10060248-10060270 CCAGCCAAGCTCTACCATGAAGG + Intergenic
986816510 5:11418204-11418226 CGAGGCCAGCCTTACCATCATGG + Intronic
986829356 5:11559037-11559059 CTTGGCCAGCCATACCCTGGGGG - Intronic
995558352 5:113354273-113354295 ATAGCCCAACCCTACCCTGAAGG + Intronic
998480549 5:142459315-142459337 CCAGGCCATCCCTGGCCTGAAGG + Intergenic
999302641 5:150500675-150500697 CCAGGCCAGGCTTTCCCTGTGGG - Intronic
999306558 5:150523217-150523239 CCAGGCCAGCGTTCCCCTGAGGG - Intronic
999315288 5:150579566-150579588 TCAGGCCATCCCTAGCTTGAAGG - Intergenic
1001845272 5:174916555-174916577 TGAGACCAGCCCTACCCGGAGGG + Intergenic
1001984336 5:176061103-176061125 CCAGGCGGGCCCTCCCCTTAAGG + Intronic
1002159997 5:177309412-177309434 ACAGGCCAGCCAGCCCCTGAGGG + Intronic
1002164900 5:177338071-177338093 ACAGGACAGCCCTACCCAGGAGG + Intronic
1002233140 5:177782962-177782984 CCAGGCGGGCCCTCCCCTTAAGG - Intronic
1003098685 6:3160712-3160734 CTGAGCCACCCCTACCCTGAAGG + Intergenic
1003380395 6:5619702-5619724 CCAGGCCAGCCACACCGAGAAGG - Intronic
1006018774 6:31104212-31104234 CTGGGCCAGCCCTAGCCAGAGGG - Intergenic
1006019165 6:31107313-31107335 CCAGACCAGCCCTCCTCTGTGGG + Intergenic
1006500910 6:34458189-34458211 TCAGGCCCTCCCTAGCCTGAAGG - Intergenic
1006503041 6:34470035-34470057 CCAGCCCAGCCCTCCCCTCCAGG - Intronic
1006593333 6:35174058-35174080 CCAGGCCAGGTCTACCACGAAGG + Intergenic
1006631812 6:35435654-35435676 CCAGGCTATCCCTGCCCCGATGG - Intergenic
1007703641 6:43778401-43778423 CCCAGCCAGCCATACCCAGATGG - Intronic
1007775435 6:44222229-44222251 CCCCGCCAGCCCTAACCAGAGGG - Intronic
1008298503 6:49805991-49806013 CACGGCCACCCCTCCCCTGAGGG - Intergenic
1009588618 6:65637964-65637986 TCAGGCCATCCCTGCCTTGAAGG - Intronic
1010415157 6:75603067-75603089 CAAGGCCAGGCCTAATCTGAAGG - Intronic
1010696439 6:78980136-78980158 GCAGGCCAGACTTGCCCTGAGGG - Intronic
1013101980 6:106994930-106994952 CCGTGCCCGGCCTACCCTGAAGG - Intergenic
1014770471 6:125453401-125453423 TCAGGCCATCCCTGGCCTGAAGG - Intergenic
1016457451 6:144245652-144245674 CTAGACCAGCCCTAGCCAGAGGG - Intergenic
1017856919 6:158357673-158357695 CGAGGCCTGGCCTTCCCTGAGGG + Intronic
1019187488 6:170229302-170229324 CCAGGCCTCCCCTGCCCTGCTGG + Intergenic
1019506525 7:1394147-1394169 TCAGGCCTGCCCTGCCCTCAAGG + Intergenic
1021168333 7:17368084-17368106 CCAGGGCAGCCCTCCACTGATGG - Intergenic
1022112399 7:27239661-27239683 CCAGGCCAGCCCAGCCCCGGCGG + Intergenic
1022600318 7:31751920-31751942 CCAGGACAGCCCTACAAAGAAGG - Exonic
1023843472 7:44108998-44109020 CCACACCAGGCCTGCCCTGAAGG + Intronic
1024024608 7:45400008-45400030 TCAGGCCATCCCTGGCCTGAAGG - Intergenic
1025995363 7:66524197-66524219 CCATGCCTGGCCCACCCTGAAGG - Intergenic
1027146573 7:75699724-75699746 CCAGGCCTACCAGACCCTGAAGG + Intronic
1027224328 7:76234521-76234543 CCAGGGCAGCCCTACAGAGAGGG - Intronic
1028233306 7:88330542-88330564 TCAGGCCCTCCCTAGCCTGAAGG - Intergenic
1028299574 7:89180953-89180975 TCAGGCCAGCACTAGCCAGAGGG - Intronic
1030966202 7:115995883-115995905 TTAGACCAGCCCTACCCGGAGGG + Intronic
1032939035 7:136767686-136767708 TCAGACCAGCCCTAGCCAGAGGG + Intergenic
1033648131 7:143320788-143320810 CCAGGTTAAACCTACCCTGAAGG - Exonic
1034126294 7:148674922-148674944 TTAGGCCAGCCCTAGCCAGAGGG + Intergenic
1035158745 7:156935503-156935525 CCAGGCCTGGCCCACTCTGAGGG - Intergenic
1036610411 8:10345065-10345087 CCAGGCCAGGCTAACCTTGAGGG - Intronic
1037517336 8:19645830-19645852 CCAGGCCAGCACTGCCCTGGGGG - Intronic
1037605412 8:20433921-20433943 CTGGGCCATCCCTCCCCTGATGG - Intergenic
1037664385 8:20955523-20955545 CCTAGCCACCCTTACCCTGAAGG - Intergenic
1037899852 8:22681566-22681588 CCAGGCCAGCCCTGGGCTGCAGG - Intergenic
1037936895 8:22921061-22921083 CCCGGCCTGCCCTGCCCTGCAGG - Intronic
1038149317 8:24928225-24928247 TCAGGCGTGCCCTAGCCTGAAGG - Intergenic
1038441173 8:27571776-27571798 CCAGGCCAGAAGGACCCTGAAGG - Intergenic
1038456209 8:27673389-27673411 CCAGGCCAGACCTGCCCCAAGGG + Intronic
1040661832 8:49583189-49583211 CCAGGCCCTCCCTGGCCTGAAGG - Intergenic
1040725649 8:50378957-50378979 TCAGGCCCTCCCTGCCCTGAAGG + Intronic
1042334042 8:67611797-67611819 AGAGGCCAGCCCTAGCCTGCTGG + Intronic
1043082551 8:75784608-75784630 TCAGGCCATCCCTGGCCTGAAGG + Intergenic
1043702849 8:83312856-83312878 TCAGGCCATCCCTTGCCTGAAGG + Intergenic
1044932159 8:97260772-97260794 ACAGCCCAGCCCAACCCGGAGGG + Intergenic
1046745512 8:117871783-117871805 CCACCCCAGCCCTACCCTAGGGG - Intronic
1046984168 8:120369332-120369354 CCAGGCCGACTCTCCCCTGAAGG - Exonic
1048335801 8:133501334-133501356 CCAGCCCAGCCCTATCCGGCAGG + Intronic
1049225680 8:141449468-141449490 CCAGTCCAGCCCCAGCCTGGAGG - Intergenic
1049386337 8:142344818-142344840 GCAGCCCAGCCCTGGCCTGAGGG - Intronic
1049482684 8:142834479-142834501 CCAGGCCCACCCTGCCCTCAAGG - Intronic
1049685319 8:143937099-143937121 CCAAGCCAGCCCCGCCCTGTGGG - Intronic
1049729551 8:144168876-144168898 CCTGGGCAGCCCCTCCCTGAGGG - Intronic
1050812179 9:9762106-9762128 CCAGGACAGTCCTGCCCTCAAGG + Intronic
1052633576 9:31071717-31071739 TCAGGCCCTCCCTAGCCTGAAGG + Intergenic
1053289531 9:36870931-36870953 CCAGGCAGCCCCTGCCCTGAGGG - Intronic
1053353902 9:37430831-37430853 ACAGGCCAGGCCCACTCTGACGG - Intronic
1054454414 9:65422270-65422292 GCTGCCCAGCCCTACCCTGGGGG - Intergenic
1054456578 9:65434384-65434406 CCAGGCCTTCCCGACCCTGTTGG + Intergenic
1056581395 9:87889841-87889863 CCAGGCCAGCCCTTGCCTTCTGG - Intergenic
1056940866 9:90954970-90954992 GCAGGCAATCCCCACCCTGATGG - Intergenic
1057802719 9:98199796-98199818 CCTGACCAGCCCTTCCCTGCTGG - Intronic
1060974165 9:127754954-127754976 CCAGCCCAGCCCGACCCTGCCGG + Intronic
1061207092 9:129171089-129171111 CCACTCCAGCCCTATCCTGCTGG + Intergenic
1061271579 9:129546765-129546787 CCAGGCCAGCCCTACACTAGGGG - Intergenic
1061907960 9:133708470-133708492 CTAGGCTAGCCCTTCCCTGACGG - Intronic
1061951006 9:133935804-133935826 CGAGGCCAGGCCCACGCTGAAGG + Intronic
1062200387 9:135299803-135299825 CGAGGCCAGCCCTGCACGGAGGG + Intergenic
1062380339 9:136284008-136284030 CCAAGCCCGCCATCCCCTGAGGG + Intronic
1062544292 9:137054666-137054688 CCAGGCCAGAACTACCCTTGAGG + Intergenic
1062582138 9:137233461-137233483 GGAGGCCCGCCCTGCCCTGATGG + Intronic
1185575888 X:1171925-1171947 GCAGGCCACCCCTTCACTGAGGG + Intergenic
1186521312 X:10209175-10209197 CATGCCCAGCCCTACCCAGACGG - Intronic
1186582105 X:10831099-10831121 TCAGGCCAGCCACAGCCTGATGG + Intronic
1192729216 X:73785703-73785725 GGTGACCAGCCCTACCCTGAAGG + Intergenic
1192872588 X:75198980-75199002 ATAGGCCAGCCCTGCCTTGAGGG + Intergenic
1193661104 X:84259456-84259478 CCAGGCCAACCTTACCCATAGGG - Intergenic
1193786001 X:85760445-85760467 CCAGTCCTGCCCCAACCTGATGG - Intergenic
1194095654 X:89636114-89636136 TTAGGCCAGCCCTAGCCGGAGGG + Intergenic
1199661064 X:150051679-150051701 CCAGGGCAGCCCTCCCATCAAGG + Intergenic
1199883443 X:151995283-151995305 GCATGCCAGCCCTACCCCAAGGG - Intergenic
1200448653 Y:3297482-3297504 TTAGGCCAGCCCTAGCCAGAGGG + Intergenic
1200749158 Y:6929149-6929171 TCAGGCCATCCCTGGCCTGAAGG + Intronic
1202232398 Y:22670483-22670505 CCAGGCCATCCCTGGGCTGAGGG - Intergenic
1202310758 Y:23525675-23525697 CCAGGCCATCCCTGGGCTGAGGG + Intergenic
1202560044 Y:26144919-26144941 CCAGGCCATCCCTGGGCTGAGGG - Intergenic