ID: 966771728

View in Genome Browser
Species Human (GRCh38)
Location 3:183510321-183510343
Sequence CACCAGGACCTGCCTTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 258}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966771728_966771733 5 Left 966771728 3:183510321-183510343 CCTTCTGAAGGCAGGTCCTGGTG 0: 1
1: 0
2: 3
3: 35
4: 258
Right 966771733 3:183510349-183510371 AGGGACAGGACAGACCTGACTGG 0: 1
1: 0
2: 4
3: 29
4: 203
966771728_966771737 11 Left 966771728 3:183510321-183510343 CCTTCTGAAGGCAGGTCCTGGTG 0: 1
1: 0
2: 3
3: 35
4: 258
Right 966771737 3:183510355-183510377 AGGACAGACCTGACTGGGGAGGG 0: 1
1: 0
2: 1
3: 29
4: 331
966771728_966771734 6 Left 966771728 3:183510321-183510343 CCTTCTGAAGGCAGGTCCTGGTG 0: 1
1: 0
2: 3
3: 35
4: 258
Right 966771734 3:183510350-183510372 GGGACAGGACAGACCTGACTGGG 0: 1
1: 0
2: 0
3: 18
4: 179
966771728_966771738 15 Left 966771728 3:183510321-183510343 CCTTCTGAAGGCAGGTCCTGGTG 0: 1
1: 0
2: 3
3: 35
4: 258
Right 966771738 3:183510359-183510381 CAGACCTGACTGGGGAGGGTTGG 0: 1
1: 0
2: 3
3: 37
4: 346
966771728_966771735 7 Left 966771728 3:183510321-183510343 CCTTCTGAAGGCAGGTCCTGGTG 0: 1
1: 0
2: 3
3: 35
4: 258
Right 966771735 3:183510351-183510373 GGACAGGACAGACCTGACTGGGG 0: 1
1: 0
2: 5
3: 33
4: 219
966771728_966771742 28 Left 966771728 3:183510321-183510343 CCTTCTGAAGGCAGGTCCTGGTG 0: 1
1: 0
2: 3
3: 35
4: 258
Right 966771742 3:183510372-183510394 GGAGGGTTGGCAGGAGCTGTGGG 0: 1
1: 0
2: 2
3: 55
4: 526
966771728_966771743 29 Left 966771728 3:183510321-183510343 CCTTCTGAAGGCAGGTCCTGGTG 0: 1
1: 0
2: 3
3: 35
4: 258
Right 966771743 3:183510373-183510395 GAGGGTTGGCAGGAGCTGTGGGG 0: 1
1: 0
2: 5
3: 60
4: 641
966771728_966771736 10 Left 966771728 3:183510321-183510343 CCTTCTGAAGGCAGGTCCTGGTG 0: 1
1: 0
2: 3
3: 35
4: 258
Right 966771736 3:183510354-183510376 CAGGACAGACCTGACTGGGGAGG 0: 1
1: 0
2: 2
3: 22
4: 276
966771728_966771740 19 Left 966771728 3:183510321-183510343 CCTTCTGAAGGCAGGTCCTGGTG 0: 1
1: 0
2: 3
3: 35
4: 258
Right 966771740 3:183510363-183510385 CCTGACTGGGGAGGGTTGGCAGG 0: 1
1: 0
2: 1
3: 39
4: 376
966771728_966771731 -9 Left 966771728 3:183510321-183510343 CCTTCTGAAGGCAGGTCCTGGTG 0: 1
1: 0
2: 3
3: 35
4: 258
Right 966771731 3:183510335-183510357 GTCCTGGTGAGAGTAGGGACAGG 0: 1
1: 0
2: 2
3: 23
4: 211
966771728_966771741 27 Left 966771728 3:183510321-183510343 CCTTCTGAAGGCAGGTCCTGGTG 0: 1
1: 0
2: 3
3: 35
4: 258
Right 966771741 3:183510371-183510393 GGGAGGGTTGGCAGGAGCTGTGG 0: 1
1: 0
2: 10
3: 112
4: 1009

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966771728 Original CRISPR CACCAGGACCTGCCTTCAGA AGG (reversed) Intronic
900576240 1:3383860-3383882 CACCAGGACACACCTGCAGAAGG + Intronic
900576247 1:3383894-3383916 CACCAGGACACACCTGCAGAAGG + Intronic
901183266 1:7356252-7356274 CCCCAGGAACTGCCTGCAGAGGG - Intronic
902111658 1:14084104-14084126 CACCATCACCTCCCTCCAGAGGG - Intergenic
902230233 1:15023025-15023047 GCCCAGGCCCTGCCTTCAGGTGG + Intronic
902336557 1:15757995-15758017 CACCGGGACCCACCTGCAGAGGG + Intronic
902598288 1:17523805-17523827 CACCAGCCCCTGCACTCAGATGG - Intergenic
905938644 1:41844924-41844946 CACCAGGAACAGCCTGGAGAGGG + Intronic
906862591 1:49377820-49377842 CACCTGTACCTGGCTCCAGAGGG + Intronic
907982843 1:59501700-59501722 CTCCACGGCATGCCTTCAGAGGG - Intronic
908279480 1:62516716-62516738 CAACAGGCCCAGCCTTCAGAAGG + Intronic
908692275 1:66795857-66795879 CACCAGGACCTGTCGTGAGGTGG - Intergenic
910845809 1:91603814-91603836 CACCAGGCCCTGTCTGCAAAAGG - Intergenic
911152045 1:94605401-94605423 TACCAGGACCTGGCATCAGTGGG - Intergenic
913320310 1:117583281-117583303 AACAAGGCCCTGCCCTCAGAAGG + Intergenic
917218345 1:172701410-172701432 CACCAAGGTCTGTCTTCAGATGG - Intergenic
917458091 1:175202810-175202832 CACCAGGACCAGCCTAGATATGG - Intergenic
918983117 1:191588981-191589003 CACCCTGGCCTGCCTTCAGCAGG - Intergenic
919754255 1:201056810-201056832 CAGCAGGACCTGCCTTATGAAGG - Intronic
920276941 1:204813545-204813567 TGCCAGGCCCTGCCTGCAGAGGG - Intergenic
921793895 1:219320596-219320618 CACCAGGACCTGTCGTGGGATGG - Intergenic
921887046 1:220317441-220317463 CACCATGGCCTTCCTGCAGAGGG + Intergenic
922211737 1:223491637-223491659 CAGCAGGAACTGGCTCCAGACGG - Intergenic
922469819 1:225869139-225869161 CTCCATGACCTGCCCTCAGGTGG - Intronic
924850707 1:247827537-247827559 CACCAGCAGCCGCTTTCAGAGGG - Intergenic
1064193488 10:13227230-13227252 CACTAGGAGATGCCTTCCGAGGG + Intronic
1067568070 10:47352283-47352305 CACTGGGCCCTGCCTGCAGAGGG - Intronic
1068284184 10:54913334-54913356 CTCCAGGTCCAGCCATCAGAAGG + Intronic
1068449859 10:57171950-57171972 CACCAGGACCTACCTGCAGGTGG + Intergenic
1069630571 10:69894891-69894913 CACCCGGACCAGCCTCCAGGAGG - Intronic
1070467042 10:76733897-76733919 CACCAGGGCATGCCAACAGATGG - Intergenic
1073051983 10:100673114-100673136 CACCAGGAACTGCCATCATTTGG - Intergenic
1073298085 10:102453202-102453224 CCCCAGCACCTGCCTTCAAAAGG - Intergenic
1073318851 10:102601522-102601544 CACCAGGACCTGTAGTCTGAGGG + Intronic
1074695296 10:116045186-116045208 AACCAGGACAAGCCTTCGGATGG + Intergenic
1075631637 10:124004093-124004115 GACCAGGACCTGACTTTAAAGGG + Intergenic
1076125624 10:127971643-127971665 CCCCAGGAACTGCCTTGTGAGGG - Intronic
1076156516 10:128209931-128209953 CCCCAGGACCTTCCCTCAAAGGG + Intergenic
1076380665 10:130022744-130022766 CTCCAGGACCTGCGTGCAGGAGG - Intergenic
1076481338 10:130786929-130786951 CCCCAGAGCCTGCCTTCAGGAGG + Intergenic
1076481465 10:130787841-130787863 CCCCAGAGCCTGCCTTCAGGGGG - Intergenic
1076849019 10:133083927-133083949 CATCAGGACGTCCCCTCAGAGGG + Intronic
1077246560 11:1542139-1542161 CACCATGACCTGCCTACCAAAGG + Intergenic
1077462474 11:2717537-2717559 CACCAGGGCCTGGCTTAGGATGG + Intronic
1077768493 11:5188951-5188973 CACCAGGACCTGCCTTAATAAGG + Intergenic
1078026043 11:7696586-7696608 CTCCATGATCTGCCTACAGACGG - Exonic
1078242924 11:9546854-9546876 AACCACTACCTGACTTCAGATGG - Intergenic
1078844417 11:15108465-15108487 CATCATGCCCTGCCCTCAGACGG - Intergenic
1079294341 11:19218921-19218943 CAGCAGGACCCGCCCTCAGGAGG + Intergenic
1079882271 11:25943488-25943510 CAGGACGACCTGCCTACAGAGGG - Intergenic
1080408863 11:32004576-32004598 CAGCAGGACCTGGTTTCAGGAGG + Intronic
1080584003 11:33665682-33665704 CACAAGGCCCTACCTTCAGAAGG - Intronic
1080725536 11:34896557-34896579 CACCAGGGCCTGTCAGCAGATGG + Intronic
1081485319 11:43522761-43522783 CACCAGGGGCTGCGTTCAGAAGG - Intergenic
1081918588 11:46751024-46751046 CACCAGGATATGCTTTCCGAAGG - Intronic
1083639531 11:64138039-64138061 CACCATCCTCTGCCTTCAGAGGG + Intronic
1083718710 11:64593426-64593448 AACCTGGAGCTACCTTCAGATGG + Exonic
1083897659 11:65628186-65628208 CCACAGGCCCTGCCCTCAGAGGG - Intronic
1084503958 11:69553702-69553724 CACCAGGCCCTGCCCTCCCAGGG + Intergenic
1085522509 11:77146736-77146758 CCCCAGGACCTGCCTTCTGGGGG - Intronic
1085638076 11:78173394-78173416 CACCAGGGCCTTCTTACAGATGG + Exonic
1085643430 11:78207697-78207719 CCCCAGGACCTGCCTGCATCTGG + Intronic
1088775288 11:113076425-113076447 CAACATTAGCTGCCTTCAGAGGG + Intronic
1089844909 11:121451160-121451182 AACCAGGATCTGAGTTCAGAGGG + Intergenic
1090101862 11:123805923-123805945 CAGCAGGGCCTGCCTTCTGCTGG - Exonic
1090288931 11:125524978-125525000 CACCATGCCCGGCCTTAAGAAGG - Intergenic
1091257893 11:134206824-134206846 CAGCCTGACCTACCTTCAGATGG - Intronic
1091808388 12:3374471-3374493 CACAAGGGCCTGCACTCAGATGG + Intergenic
1092107237 12:5930538-5930560 TACCAGGGCATGCCTTCAGCAGG - Intronic
1092181082 12:6447401-6447423 CAGCAGCACCTGGCTGCAGAAGG + Intronic
1096816194 12:54203426-54203448 CACCAGTGCCTACTTTCAGAAGG + Intergenic
1097130845 12:56809861-56809883 CAGGATGACCTGCCTGCAGAGGG - Intergenic
1098440679 12:70514040-70514062 CACCCTGGCCTGCCTTCAGCAGG - Intergenic
1099338702 12:81398744-81398766 CAACAGGACATGCCTTAATATGG - Intronic
1102386052 12:112511208-112511230 CTTCAGGAACTGCCTTCTGACGG - Intergenic
1104353892 12:128068237-128068259 CCCTAGCACCTGCCTGCAGAGGG - Intergenic
1104573853 12:129948974-129948996 CACCATGCCCTGCCATCACATGG - Intergenic
1104751901 12:131245307-131245329 GTCCAGGCCCTGCCCTCAGAGGG + Intergenic
1104916903 12:132270318-132270340 CACCAGGAACCTCCTCCAGAAGG + Intronic
1111160180 13:84384363-84384385 CACTTGCACCAGCCTTCAGATGG + Intergenic
1114814524 14:25941796-25941818 CACCAGGGCATGCCCTAAGAGGG + Intergenic
1118787016 14:69054506-69054528 AACCAGGACCTGCCACCTGAAGG - Exonic
1119436957 14:74603783-74603805 CTCCAGGCCCTGCCTCTAGAAGG - Intronic
1119704241 14:76774128-76774150 TCCCAGGACCTGCCCTCAGATGG - Intronic
1120182033 14:81353732-81353754 CACCAAGACCTGTGTCCAGAAGG + Intronic
1120591986 14:86386480-86386502 CACCTGTCCCTGCCTTCAGGGGG - Intergenic
1120793982 14:88610901-88610923 CACCACGACATGCCTTGAAATGG + Exonic
1122711623 14:103662831-103662853 CTCCAGGGCCTGCTTGCAGAGGG - Exonic
1122919555 14:104874440-104874462 CACCAGGATCCGCCTTCCCAGGG + Intronic
1124144948 15:27116093-27116115 CACCATGGCCTGCCTTCAGCAGG - Intronic
1124150098 15:27169518-27169540 CACCACGGCCTCCCCTCAGATGG - Intronic
1126740649 15:51773158-51773180 CAGCATGACCTGCCTTCTGGAGG + Intronic
1127638078 15:60890032-60890054 CAATAGGGCCTGCCTTCAGTAGG - Intronic
1127645563 15:60955013-60955035 CACCACGCCCAGCCTTAAGATGG - Intronic
1127972686 15:63973875-63973897 AACCAGGGCCTGCCTGGAGAAGG - Intronic
1128254366 15:66186039-66186061 CCCCAGGACCTTCCTTCATAGGG + Intronic
1128749592 15:70139596-70139618 CAGCAGGAGCTGACTTTAGAGGG - Intergenic
1131632687 15:94195932-94195954 CTGAAGGATCTGCCTTCAGAAGG + Intergenic
1132128097 15:99247698-99247720 AACCAGGACTTGCCTGCAAATGG + Intronic
1132550865 16:553329-553351 CACCAGGACCTGCCTGGGGGAGG - Exonic
1132747298 16:1442379-1442401 CACCAGGCCCAGGCTTCAGGGGG - Intronic
1132980832 16:2738016-2738038 CACCAGGAGATCCCTACAGAGGG - Intergenic
1133008728 16:2898474-2898496 CACCAGGAGGTCCCTGCAGAGGG + Intronic
1133162408 16:3920721-3920743 AACGAGGAACTGCCTGCAGAAGG - Intergenic
1135303193 16:21348043-21348065 CACGATGACCTGTCTTCAGAGGG - Intergenic
1135319495 16:21482763-21482785 CACCGGGCCCTGCCTTGAGTGGG - Intergenic
1135372332 16:21914251-21914273 CACCGGGCCCTGCCTTGAGTGGG - Intergenic
1135439454 16:22456457-22456479 CACCGGGCCCTGCCTTGAGTGGG + Intergenic
1135808454 16:25565715-25565737 CACCTGGAGTTGCATTCAGATGG - Intergenic
1136299935 16:29327235-29327257 CACGATGACCTGTCTTCAGAGGG - Intergenic
1138563093 16:57813752-57813774 CTGCAGCACGTGCCTTCAGAGGG + Intronic
1139021222 16:62752402-62752424 GACAATTACCTGCCTTCAGACGG - Intergenic
1140062187 16:71580468-71580490 CACCATGGCCTGTCTTCAGCAGG - Intergenic
1140326254 16:74005906-74005928 CACCTGCACATGCCTTCAGTGGG - Intergenic
1141949606 16:87332158-87332180 GACCAGGGCCTGGCCTCAGAGGG + Intronic
1142061669 16:88034002-88034024 CACGATGACCTGTCTTCAGAGGG - Intronic
1142126902 16:88414836-88414858 CACCCGGCCCTGCCTTCCCAGGG + Intergenic
1142503892 17:350766-350788 CATCAGGGCCTGCGGTCAGAGGG - Intronic
1143370445 17:6435844-6435866 CCCCAGAATCTGCCTTCAGGAGG + Intergenic
1144076776 17:11726758-11726780 CACCATGCCCAGCCTTCAGTGGG - Intronic
1144724351 17:17494283-17494305 CAGCTGAAGCTGCCTTCAGAAGG + Intergenic
1146371905 17:32269950-32269972 ACCCAGGACCTACCTTCAGTTGG - Intronic
1147119407 17:38327079-38327101 CTCCAGGTCCTGCCTTCTGAAGG + Exonic
1147135975 17:38434408-38434430 AAAGAGGACCTGCCTTCCGAGGG - Intronic
1147871256 17:43589139-43589161 CACCCTGGCCTGCCTTCAGCAGG + Intergenic
1148858776 17:50593323-50593345 TGGCAGGAGCTGCCTTCAGAAGG - Intronic
1154165047 18:12008570-12008592 CACAGGGACCAGCCTGCAGAAGG + Intronic
1156548519 18:37990196-37990218 CATCTTGACCTGCCTTCAGGAGG + Intergenic
1161364993 19:3873577-3873599 CACCATGCCCGGCCTTCTGAAGG - Intergenic
1161394072 19:4035418-4035440 AACCAGGGCCTGCCTCCAGTTGG + Intronic
1161747586 19:6070376-6070398 GACCAGGACCCCCCTCCAGAAGG - Intronic
1162015164 19:7841634-7841656 GTCCAGGACCCCCCTTCAGATGG + Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1163368621 19:16889708-16889730 CACCAGGACCAGCCCATAGAGGG - Exonic
1164920344 19:32084400-32084422 CTGCAGGACCTGCCTTTAGGGGG - Intergenic
1165483873 19:36083570-36083592 CACCAGGACCCTCCTCCAGCTGG - Intronic
1165554429 19:36617757-36617779 CACCATGACCTGCTTTCAGTAGG - Intronic
1168500153 19:56886050-56886072 CACCCGGGGCTGCCTTCAGCAGG - Intergenic
925225248 2:2178550-2178572 CACCAACACCTTCCTGCAGAAGG - Intronic
925762387 2:7198076-7198098 CCCCTTGACCTTCCTTCAGATGG - Intergenic
926854104 2:17233498-17233520 CACCAGGACCTACTTTAGGATGG + Intergenic
926862029 2:17320100-17320122 CACAAGGTCCTGCACTCAGAAGG - Intergenic
929493569 2:42419539-42419561 CACCACGCCCAGCCCTCAGATGG + Intronic
930027993 2:47041141-47041163 CCCCAGGTCCTGCTTTCACAGGG + Intronic
930729985 2:54719660-54719682 CACCAGGACCTGCCATCATCAGG - Intergenic
932085237 2:68751840-68751862 GGCCAGGACCAGCCTTCAGCAGG - Intronic
932189725 2:69730620-69730642 CACCTGGGCCTGCCTCCACATGG + Intronic
933153342 2:78941239-78941261 CACCAGGGCCAGTTTTCAGATGG - Intergenic
935315869 2:101833330-101833352 CACCATGCCCGGCCATCAGATGG - Intronic
935562037 2:104569187-104569209 CACCTTGGCCTGCCTTCAGCAGG - Intergenic
935616183 2:105084363-105084385 CGCCAGGAGCTTCCTTCACAAGG - Intronic
936007197 2:108900265-108900287 CACCAGGCCCAGCCTTTAGTTGG - Intronic
936879535 2:117233105-117233127 CACCTGGACTTGCATACAGATGG - Intergenic
937362787 2:121240636-121240658 CACCAGGACCTCTCTTCCCAGGG + Intronic
943277788 2:185890306-185890328 CACAAGGACCTCTCTTCATAGGG + Intergenic
944916730 2:204368564-204368586 CAGCAGGTAGTGCCTTCAGAAGG - Intergenic
947382901 2:229562650-229562672 CACCAGGCTCTGCCACCAGATGG + Intronic
948807059 2:240457589-240457611 CTCCAGGCCCTGCCTGCAGTGGG + Intronic
1168841455 20:912548-912570 CCCCAGGAGCTGGCTCCAGATGG + Intronic
1170373654 20:15677454-15677476 TACCTGGACCTGCCTTCATGGGG - Intronic
1170714969 20:18823651-18823673 CACCAGGCCCTGCCCGCAGTAGG - Intronic
1170823323 20:19772482-19772504 CACAGGGCCCTGCATTCAGAAGG - Intergenic
1171313527 20:24166203-24166225 CACCCCGACCTACCTTCAGCAGG + Intergenic
1171458737 20:25286696-25286718 GGCCAGGACCTGCCTTGTGAGGG + Intronic
1175279620 20:57794385-57794407 CACCATGGCCTGCCTTCAGCAGG - Intergenic
1175741082 20:61420213-61420235 CAGGAGGAGCTGCCTGCAGAGGG - Intronic
1176874797 21:14116971-14116993 CTCCAGCAGCTGCCTCCAGAGGG + Intronic
1179600708 21:42475800-42475822 CACCAAGGCCTGCCTTCAGCTGG - Intronic
1181085812 22:20438837-20438859 CACTAGGACCTGGCTACACACGG - Intronic
1181534662 22:23535111-23535133 GACCAGGCCTTGCCTTCGGAGGG - Intergenic
1183521122 22:38296611-38296633 CTCCAGGGCCTGCCTCAAGAGGG + Intronic
1184119313 22:42440074-42440096 CCCCAGGGCCTGGCTTCAGGTGG + Intergenic
1184143347 22:42592880-42592902 CACCTGCAACTGCCTTCACAAGG + Intronic
1184885799 22:47343817-47343839 CAGCAGGACCCGCCCTCCGAAGG + Intergenic
1184914889 22:47562626-47562648 GACCAGGGGCTGCCTGCAGAGGG + Intergenic
950461221 3:13123361-13123383 CGCCAGCACCAGCCTTCAGTGGG - Intergenic
950908969 3:16567570-16567592 CTCCAGGAGCTGCCATCACATGG - Intergenic
952167375 3:30765583-30765605 AACAAGGCCCTGCCCTCAGAAGG + Intronic
952172634 3:30825757-30825779 CACCAGGGCCTGTCCTCAGGTGG + Intronic
954198903 3:49012716-49012738 GACCAGGAGCTGCCTCCAGCAGG - Exonic
954705917 3:52480423-52480445 CGCGAGGACCAGCCTGCAGAAGG - Intronic
954872656 3:53779528-53779550 CACCAGGTCCAGCTTGCAGATGG - Intronic
955028389 3:55192141-55192163 CACCAGGACCATCTTTCAGTGGG + Intergenic
956119991 3:65956707-65956729 CACCATGCCCTGCCTTCAATAGG - Intronic
957356330 3:79092171-79092193 CAACAGGACTTGCTTTCAGATGG + Intronic
961332211 3:126149088-126149110 CACCAGAAGCTGCCTTTGGACGG + Intronic
961490565 3:127254255-127254277 CACCAGGACCTGCCCCCACGTGG + Intergenic
963699780 3:148609956-148609978 CACCATGCCCGGCCTGCAGAAGG + Intergenic
964692145 3:159461919-159461941 CATCATGCCCAGCCTTCAGATGG - Intronic
965495403 3:169391896-169391918 CACCAGGCACTGCCTTCTAATGG + Intronic
966297435 3:178440603-178440625 CACCAGGACCTGGCTTCGCATGG + Intronic
966555648 3:181257521-181257543 CACCAGGACCTGGTATCAGTTGG + Intergenic
966771728 3:183510321-183510343 CACCAGGACCTGCCTTCAGAAGG - Intronic
967234461 3:187370774-187370796 CACCGGAACCTGCAGTCAGAAGG - Exonic
967975756 3:195034015-195034037 CACCTTGGCCTGTCTTCAGACGG + Intergenic
969121317 4:4913481-4913503 CCCCAGGGCCTGTCCTCAGAAGG - Intergenic
969575440 4:8033694-8033716 CCCCAGGACCTGTCCCCAGAGGG - Intronic
969606362 4:8204142-8204164 CTCCATGCCCTGCCTGCAGAGGG + Intronic
970387368 4:15569055-15569077 CACCAGGACAAGCCAGCAGAGGG + Intronic
971039779 4:22738836-22738858 CAGCAGGACAGGCCTTCAGCAGG - Intergenic
971301072 4:25442862-25442884 CAGCAGGAGCTGCCTCCCGATGG + Intergenic
976051104 4:81012349-81012371 CATCAGGCCATGGCTTCAGAGGG + Intergenic
979524995 4:121707153-121707175 CACCTCGGCCTGCCTTCAGCAGG - Intergenic
980456575 4:133051886-133051908 CACCAGGACCTACTTGAAGATGG + Intergenic
984479230 4:180277561-180277583 CACCATGCCCAGCCTCCAGAAGG - Intergenic
985538671 5:477945-477967 CTCCAGGCCCTGCCATCAGGCGG - Intronic
985576220 5:674645-674667 CACCAGGACCTGCCAGCAGCTGG + Intronic
985631629 5:1017120-1017142 CACCAGGACGTGCCTGGACATGG + Intronic
987680342 5:21128477-21128499 CACAAGTAGTTGCCTTCAGAGGG - Intergenic
987857355 5:23438180-23438202 CATCAGGCCCTGCATTCTGATGG + Intergenic
988022064 5:25633440-25633462 CACCAGGACCTGTCTTGGGTAGG + Intergenic
990661034 5:58015328-58015350 CACAAGGCCCTGTGTTCAGATGG - Intergenic
992232273 5:74675197-74675219 CACCCTGGCCTGCCTTCAGCAGG - Intronic
994322070 5:98405632-98405654 CAACAGCACCTACCTACAGAAGG + Intergenic
994443809 5:99845677-99845699 CATCAGGGCCTGCCTTAAGCAGG + Intergenic
996776384 5:127136914-127136936 CACCAGGGCCATCCTTCAAATGG + Intergenic
999259755 5:150230712-150230734 CACCTGGACTTGCCTTTGGAGGG - Intronic
999282756 5:150375780-150375802 CTACAGGCCCTGCCTTCTGAGGG - Exonic
1000599316 5:163253134-163253156 CACCATGTCCTGCCGGCAGAAGG - Intergenic
1001965304 5:175906040-175906062 CACCAGGACCTGTTTTCAGAAGG - Intergenic
1002132200 5:177088437-177088459 GGCCATGACCTGCCTTGAGAAGG + Intronic
1002251646 5:177933154-177933176 CACCAGGACCTGTTTTCAGAAGG + Intergenic
1002573147 5:180155433-180155455 CACCTGGCCTTGCCTTCAGGAGG + Intronic
1003080496 6:3017420-3017442 CCCCAGGCCCTGCATTCTGATGG + Intronic
1004249678 6:14013373-14013395 CACCACCACCTGCCTTCTGATGG - Intergenic
1005876024 6:30010123-30010145 CACCAGGACCTGTGATCACAGGG + Intergenic
1006615211 6:35321447-35321469 CACCAGGACCTGGCCACAGCTGG + Exonic
1007392133 6:41555572-41555594 CACCAGAACCAGGCTCCAGATGG + Intronic
1007637185 6:43306563-43306585 CACCAGCACCTGCCTGCATATGG + Intronic
1007764127 6:44150998-44151020 CACCAAGACCTCCCTAGAGATGG - Intronic
1009973187 6:70646246-70646268 TTCCAGTACCTGGCTTCAGAGGG + Intergenic
1011063733 6:83301031-83301053 CACCAGGGCCTGCCATGGGATGG + Intronic
1011388159 6:86820219-86820241 CACCAGGACCTGTCAGCAGTAGG + Intergenic
1016402447 6:143695130-143695152 GACCAGGAATTGCCTTGAGATGG + Intronic
1018167785 6:161115838-161115860 CACCAGGATCTACCTACACAGGG - Intronic
1018170671 6:161140708-161140730 GGCCAGGACCTGCCCTTAGACGG - Intronic
1018590713 6:165418491-165418513 CACCAGGACCCGCCTCCTGAAGG - Intronic
1018996900 6:168716973-168716995 CTCCATGGCCTGCCTTGAGAAGG + Intergenic
1019188445 6:170235591-170235613 CAGCTGGACCTGCCTGCACAGGG + Intergenic
1019435646 7:1020927-1020949 CACCAGGTGGAGCCTTCAGATGG + Intronic
1019771848 7:2888152-2888174 CAGCAGCAGCTGCCTTCAGATGG + Intergenic
1020123924 7:5521960-5521982 CACCAGGCCCAGCCTAGAGATGG - Intergenic
1020281427 7:6652179-6652201 CAGCAGGACCTTCCTTCAGTCGG - Intronic
1020692330 7:11371323-11371345 CCCCAGGTCCTGCCCTCAGGTGG - Exonic
1021542822 7:21779035-21779057 CACAAAGATCGGCCTTCAGACGG + Exonic
1022132821 7:27419646-27419668 CAACTGGACATGGCTTCAGATGG + Intergenic
1022258471 7:28682212-28682234 CACCTGGAGCTGACTTCAGCAGG + Intronic
1023862716 7:44225699-44225721 CCCCAGGCCCAGCCTGCAGAGGG + Intronic
1025005993 7:55355322-55355344 CACCCTGGCCTGCCTTCAGTAGG - Intergenic
1025175791 7:56801767-56801789 GACCAGCTCCTGCCTTCAAATGG - Intergenic
1025696001 7:63774655-63774677 GACCAGCTCCTGCCTTCAAATGG + Intergenic
1025755542 7:64335128-64335150 CACCAGGGCCTGTCAGCAGATGG + Intronic
1026475094 7:70728415-70728437 CACCATGCCCGGCCTCCAGATGG - Intronic
1027337294 7:77165264-77165286 CACAAGGATCTGCTCTCAGAGGG + Intronic
1029778504 7:102705856-102705878 CACAAGGACCTGCTCTCAGAGGG - Intergenic
1030008662 7:105143541-105143563 TACCAGGTCCTGCCCTCAGAGGG + Intronic
1030463333 7:109868381-109868403 GAGCAGTACCTGCCTTTAGAGGG + Intergenic
1032767337 7:135009844-135009866 CAGCAGCATCTGCCTTCAGTGGG + Intronic
1033159225 7:138981648-138981670 CCCCAGGACCCGCCTTCCGGAGG + Intergenic
1034271932 7:149807350-149807372 CATCAGGATCTGCCAGCAGAGGG + Intergenic
1034534484 7:151718468-151718490 CACCATGACCTGCATGCAGCTGG - Intronic
1035160265 7:156944818-156944840 CACCAGGGCCCGCCTTCAGGCGG + Intergenic
1035430695 7:158818553-158818575 CACCAGGACTTGCCTGCAAGCGG + Intronic
1036280456 8:7395922-7395944 CACAGGGACCTGCCCTCAGAAGG + Intergenic
1036341014 8:7915648-7915670 CAAAGGGACCTGCCCTCAGAAGG - Intergenic
1038560449 8:28573538-28573560 CAGCAGGCCCTGACTTCATAAGG - Exonic
1041222311 8:55664042-55664064 CACCATGCCCAGCCTTCAAATGG + Intergenic
1044053726 8:87542470-87542492 CAGGATGACCTGCCTGCAGAAGG - Intronic
1045357152 8:101399433-101399455 CTCCAGGAATTGCCCTCAGATGG + Intergenic
1046505550 8:115133327-115133349 CACAACAACCTGCTTTCAGATGG + Intergenic
1047892956 8:129333300-129333322 CACCAAGTCCTGCCTTCATTGGG + Intergenic
1048561410 8:135541889-135541911 CAACAAGACCTACCTTCATAGGG - Intronic
1048893199 8:138966049-138966071 AAGCAGGGTCTGCCTTCAGAGGG + Intergenic
1049178255 8:141206937-141206959 CACCAGAACAGGCCTGCAGAAGG + Intergenic
1050674962 9:8041777-8041799 CACCAGGGCCTGCCTTGAGGTGG - Intergenic
1051113902 9:13672777-13672799 GAGCAGATCCTGCCTTCAGAAGG - Intergenic
1052775326 9:32727313-32727335 AGACAGGATCTGCCTTCAGATGG + Intergenic
1053432460 9:38052123-38052145 CACGAGGTGCTGCCATCAGATGG + Intronic
1055290003 9:74772717-74772739 CACCATGCCCTGCCATCAGTAGG - Intronic
1057603701 9:96482582-96482604 CACCATGATCTGGCTCCAGAAGG + Intronic
1057909160 9:99004775-99004797 CACCAAGACCTCACTTCACATGG - Intronic
1058868519 9:109183065-109183087 CCCCTGGAGCTGCCTTCAGCGGG + Intronic
1059341682 9:113601008-113601030 CCCCAGGACCCGACTTCAGATGG - Intergenic
1060891023 9:127188505-127188527 CCCCAGTTCCTGCTTTCAGATGG - Intronic
1060975065 9:127760236-127760258 CACCAGGCCCTGAATTCAAAGGG - Intronic
1062226986 9:135457791-135457813 CAGTAGGGCCTGCCATCAGAGGG - Intergenic
1203773362 EBV:60315-60337 CACCAGGAGGCGCCTTCTGAGGG + Intergenic
1186843283 X:13506453-13506475 CACAAGGCCCTGCACTCAGATGG + Intergenic
1187176186 X:16898167-16898189 CACCCGGACATTCCTGCAGAAGG - Intergenic
1187628415 X:21142111-21142133 CACCTGCACATGCCTTCAGAGGG - Intergenic
1188467222 X:30495671-30495693 CACAAGGCCCTGTTTTCAGAAGG - Intergenic
1193028545 X:76872961-76872983 CACCAGGGCCTGTCAGCAGATGG + Intergenic
1195440182 X:104889955-104889977 CACCAGGACCTGTCTTGGGTTGG - Intronic
1197975658 X:132163353-132163375 CCTCAGGCCCTGGCTTCAGATGG + Intergenic
1198466051 X:136905793-136905815 AACCAGGAGCTGCTTTCAAATGG + Intergenic
1200047325 X:153409850-153409872 CAACAGGAGCTGCCTTCCCAAGG + Intergenic
1200135070 X:153870817-153870839 CACCAGGACCATCATTCAGAAGG - Exonic