ID: 966774583

View in Genome Browser
Species Human (GRCh38)
Location 3:183532748-183532770
Sequence ACCTGGATCCTGCTTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966774583 Original CRISPR ACCTGGATCCTGCTTGTGGA GGG Intronic
900998967 1:6137950-6137972 ACCTGGGTGCTGGTTGGGGAGGG + Intronic
901128031 1:6943075-6943097 ACCAGCAACCTGCTTGTGGCTGG + Intronic
901978114 1:13011503-13011525 ACCTGGATGCCGTTTGTGTAGGG + Intronic
902003972 1:13217435-13217457 ACCTGGATGCCGTTTGTGTAGGG - Intergenic
902023195 1:13363179-13363201 ACCTGGATGCCGTTTGTGTAGGG - Intergenic
902509559 1:16958785-16958807 ACCTGCTTCCTGCTGGGGGAAGG - Intronic
903187958 1:21639981-21640003 GTCTGGATCCTGCTTGCGGCGGG - Intronic
903326421 1:22571402-22571424 AGCTGGAACCTGCTTGATGATGG - Intronic
903738428 1:25544424-25544446 ACCTGGACCCGGCTAGAGGAAGG - Intronic
904498488 1:30900939-30900961 GCCTTCATCCTGCTTTTGGATGG - Intronic
904903120 1:33873263-33873285 ACATGTATTCTGCATGTGGAAGG + Intronic
905006893 1:34717009-34717031 ACCTGGAGCCTGTTTGTTGCTGG - Intronic
906248952 1:44296558-44296580 AACTGGACCCAGATTGTGGAGGG - Intronic
906380874 1:45331636-45331658 ACCTGGATACTGGGCGTGGAGGG - Intronic
906573961 1:46870913-46870935 ACCTGGAGCCTGTTGGGGGATGG + Intergenic
909853442 1:80498562-80498584 ACCTTTTTCCTGCTTGTGGAAGG + Intergenic
912279255 1:108296140-108296162 TACTGGAGCCTGCTTGAGGAAGG - Intergenic
912288971 1:108398217-108398239 TACTGGAGCCTGCTTGAGGAAGG + Intronic
915213129 1:154324769-154324791 ACCTGGATGCTGGATGGGGACGG + Exonic
916490453 1:165297720-165297742 CCCTGGAGGCTGGTTGTGGAGGG - Intronic
919058763 1:192604632-192604654 ACCTGGATAATGCTTTTTGATGG + Intergenic
920657883 1:207889716-207889738 ACAAGGATCCTTCTTGCGGACGG - Intronic
920845873 1:209592588-209592610 ACCAGGACCCTGCTGGTGGGAGG - Intronic
921426523 1:215008236-215008258 ATCCTGATCCTGCTTGTGGGAGG - Intronic
921515496 1:216086717-216086739 ACCAGGATCCTTCCTGAGGATGG + Exonic
921894426 1:220384691-220384713 ACCATGATCCTCCTTGGGGATGG + Intergenic
922764705 1:228150820-228150842 TCGTGGATCCTGCGGGTGGAGGG + Intronic
924281522 1:242442375-242442397 ACCTGGATGCTGCACGTAGATGG - Intronic
1062875048 10:936375-936397 ACCTGTGTCCTTCTCGTGGATGG - Intergenic
1064972013 10:21075561-21075583 AACTGCATCGTGCTTCTGGAAGG - Intronic
1067216631 10:44309606-44309628 ACCTGCTTCCAGCTTGTAGATGG - Intergenic
1069799377 10:71072710-71072732 GCCTGGATCCTGAGTGTGGCAGG - Intergenic
1071236595 10:83657198-83657220 TCCTGGATCCTGGTTCTGCAGGG + Intergenic
1073120072 10:101116332-101116354 ACCTTGGTGCTGCTTGTGAAAGG - Intronic
1074153023 10:110775405-110775427 TCTTGGCTCCTGCTTCTGGATGG + Intronic
1076184045 10:128432678-128432700 CCCTGGCGCCTGCATGTGGATGG - Intergenic
1077092850 11:787540-787562 CCCTGAAGCCTGCGTGTGGAGGG - Exonic
1077475929 11:2790477-2790499 AGCTGGATGCTGGGTGTGGATGG - Intronic
1079133996 11:17765825-17765847 GCCTGGATCCTGGGTGTGGTGGG + Intronic
1081722855 11:45302837-45302859 ACCTGTCTCCTGCTGCTGGATGG + Intergenic
1082768615 11:57188106-57188128 ACCTGGTAGCTGCTGGTGGAAGG - Exonic
1084913105 11:72407271-72407293 ACCTCTGTCCTGCTTGTGGAAGG - Intronic
1088157267 11:106822522-106822544 AACTGGGTCCTGCTTGAGGGAGG - Intronic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1091841757 12:3626621-3626643 CCATGAATCCTGCTGGTGGAAGG + Intronic
1095513786 12:42983492-42983514 ACCTGCATCCTTCTTGTTGCAGG - Intergenic
1100182989 12:92105927-92105949 ACCGGGCACCTGCTTGGGGATGG + Intronic
1101900626 12:108788974-108788996 TCCTGGAGCCTGCTGGTGGTAGG + Exonic
1101997361 12:109534634-109534656 GCCTGGCTCCCGCTTGCGGATGG - Exonic
1102557200 12:113734963-113734985 ACGTGGATGCTGCTGGTTGACGG + Intergenic
1103243405 12:119434140-119434162 ACCTGGACCCTGCTGGGGGTAGG - Intronic
1103380385 12:120489625-120489647 ACCTGGCTACTGCATGAGGATGG - Intronic
1104007773 12:124906099-124906121 TTTGGGATCCTGCTTGTGGATGG - Intergenic
1107906681 13:45067684-45067706 ACATGGTTCCTGCCTTTGGATGG - Intergenic
1114601124 14:23956231-23956253 GCCTTGATCCTGATGGTGGAAGG + Intronic
1114605330 14:23991366-23991388 GCCTTGATCCTGATGGTGGAAGG + Intronic
1114610810 14:24038996-24039018 GCCTTGATCCTGATGGTGGAAGG + Intergenic
1114968038 14:27988507-27988529 ACCTGGATCAAGATTGTGGATGG + Intergenic
1119044293 14:71304223-71304245 ATATGGATTCTGCTTTTGGAAGG + Intergenic
1121768186 14:96505639-96505661 AACTGGTACCTGCTGGTGGATGG + Intronic
1122254814 14:100468973-100468995 AGCTGGATCCTGCTCATGGAGGG - Intronic
1122556063 14:102580704-102580726 GCCTGCTTGCTGCTTGTGGAGGG + Intergenic
1122646316 14:103196765-103196787 TCATAGATTCTGCTTGTGGAGGG + Intergenic
1124899947 15:33813055-33813077 ACCTGAATGCTGAGTGTGGAGGG - Intronic
1127350128 15:58142918-58142940 CCCTGGATTCTGCCTGTGGGTGG + Intronic
1130876375 15:88018164-88018186 AGCTGGACCCTGCTTCTGGGAGG + Intronic
1131256028 15:90863061-90863083 ACCTGGTGCCTGCTTGGGGGAGG - Intergenic
1142184991 16:88690601-88690623 CCCTGGTTCTTCCTTGTGGAAGG + Intergenic
1142502056 17:338775-338797 ACCTGGGAACTGCTTGTTGAAGG + Intronic
1143137304 17:4719098-4719120 GCCTGGAGCCTGGCTGTGGAGGG - Intronic
1143291678 17:5836149-5836171 CCCTGGATTCTGTTTGTGAAAGG + Intronic
1143404221 17:6666378-6666400 ACAAGGATCCAGCCTGTGGATGG - Intergenic
1144045743 17:11453001-11453023 ACCTGGATCCGGATTGAGGGTGG - Intronic
1144788906 17:17846801-17846823 ACCTGGTCCTGGCTTGTGGAGGG - Intronic
1151230830 17:72683958-72683980 ATCTGACTCCTGCTAGTGGAGGG + Intronic
1152742079 17:82022825-82022847 AGCTGGATCCGGCTTCCGGAAGG - Exonic
1157697981 18:49738906-49738928 ATCTGGATCCTGGTTGTGTTAGG - Intergenic
1159824453 18:73189420-73189442 ACCTATATACTGCTTGTTGAAGG + Intronic
1161060097 19:2210522-2210544 GCCTGGCTCCTGCTGCTGGAGGG + Intronic
1161820157 19:6525612-6525634 TTCTGGATCCTGGATGTGGAGGG + Intergenic
1163313771 19:16529481-16529503 ACCTGGCTCGTGCTTGTAAATGG + Intronic
1164556795 19:29259373-29259395 AGCTGGCTCCTCCTAGTGGAGGG + Intergenic
1164910980 19:32011713-32011735 ACATGGTTCCTCCTTTTGGAAGG - Intergenic
1165520705 19:36311833-36311855 ACCTGGCATCTGCTTGGGGAAGG - Intergenic
1165623366 19:37266751-37266773 ACCTGGCATCTGCTTGGGGAAGG + Intergenic
1165822580 19:38685933-38685955 AACTGGGCCCTGCTGGTGGAAGG - Intronic
1166270041 19:41708113-41708135 CCCCAGATCCTGCATGTGGAGGG - Intronic
1167179604 19:47892617-47892639 ACCTGGAGCTTGCTGGTGGTGGG + Intergenic
1168369569 19:55820957-55820979 ATCTGGAACCTGGATGTGGAAGG + Intronic
925207970 2:2023368-2023390 GCCTGGATGTTGCCTGTGGATGG + Intronic
927839419 2:26429784-26429806 ACCTGGTTTCTGCTCTTGGAGGG + Intronic
933201972 2:79461507-79461529 ACCTGGTTCCTGCTTCTTCAAGG - Intronic
933395345 2:81724019-81724041 TCCTTGATCCAGCTTGTTGAAGG - Intergenic
933969663 2:87460181-87460203 ACCTGCTTCCTGTTTGAGGACGG - Intergenic
934926965 2:98388827-98388849 ACCTGGATGCTGCAAGTGCAAGG - Intronic
936324123 2:111490316-111490338 ACCTGCTTCCTGTTTGAGGACGG + Intergenic
936400437 2:112160502-112160524 AACTGGATCCAACTTGTGGACGG - Intronic
937152204 2:119693535-119693557 CTCTGGATCTTGCCTGTGGACGG - Intergenic
937418471 2:121736480-121736502 CCCTGGAGCCTTCATGTGGAGGG - Intronic
938736539 2:134191461-134191483 ATCTGGAACCTGCTGGTGGGGGG - Intronic
939237865 2:139520807-139520829 ACCTTGATCGTGCTGGTGGTGGG + Intergenic
940338875 2:152558388-152558410 ATCTACAGCCTGCTTGTGGAAGG - Intronic
943203538 2:184860736-184860758 ACCTGGATCCTGTGTCTGCAGGG + Intronic
945180805 2:207089048-207089070 ACCTGGCTGCAGCTTGTGGTAGG - Intronic
946910645 2:224457353-224457375 ACCTGCATCTGGCTTCTGGAAGG - Intergenic
1169917373 20:10697012-10697034 GCCTGGGTCCAGCTTGTGGGAGG + Intergenic
1169985382 20:11437571-11437593 ACCTGAAGCTTGCCTGTGGATGG - Intergenic
1170902349 20:20477425-20477447 ACCTGGCACCTACTTGTGTATGG + Intronic
1171117911 20:22542484-22542506 ACCTGGGTCCTACTTGAGGGTGG - Intergenic
1171463158 20:25310094-25310116 ACATGGATGCTGCTGGGGGATGG - Intronic
1173799534 20:45886513-45886535 TCCTGGCTCCTGCTTGTAGATGG - Exonic
1175646718 20:60680353-60680375 ACATGGATCCTGCCTGCAGAGGG - Intergenic
1176037993 20:63049663-63049685 ACCTGGAGCCTCACTGTGGAGGG + Intergenic
1177842526 21:26250458-26250480 ACTTTGATCCTGCTTATGTAAGG - Intergenic
1179962955 21:44781189-44781211 AGCTGGCTCCAGCTTTTGGAGGG - Intronic
1180561726 22:16620773-16620795 ACCTTTATCCTGCTTATGCAAGG - Intergenic
1183002743 22:34875193-34875215 ATCTGGATGCTCCTTCTGGATGG + Intergenic
1183177370 22:36233985-36234007 ACCTGGATCCTGCTAGATGCCGG + Intronic
949590586 3:5490374-5490396 ACCTGTATGCTGTTTGTGGTGGG + Intergenic
950482158 3:13250908-13250930 CCCTGGATGCTGCATGTGGCAGG - Intergenic
952886887 3:38017630-38017652 GCCTGGATCCTGCTGCTGGGAGG - Intronic
953347285 3:42186707-42186729 AGCTGGATCCTCTTTGTGCAAGG - Intronic
955922942 3:63976948-63976970 ACCTGGCATTTGCTTGTGGAAGG + Intronic
962648517 3:137464374-137464396 AGCTGGGTTCCGCTTGTGGATGG - Intergenic
965099166 3:164274347-164274369 ACCTGGATCCTGGGTTTGTAGGG - Intergenic
966774583 3:183532748-183532770 ACCTGGATCCTGCTTGTGGAGGG + Intronic
972700141 4:41486338-41486360 ACCTGGATCCTGACTGACGAAGG - Intronic
976609715 4:87017755-87017777 ACTTGGGTCCTGCCTGGGGAAGG + Intronic
977379969 4:96260235-96260257 CCCTGGATCCTACTAGTGCAGGG + Intergenic
978847013 4:113285620-113285642 ACTTGGAGCTTCCTTGTGGAGGG - Intronic
981358699 4:143822259-143822281 AGCTGCATCCTTCTTGTTGATGG + Intergenic
982233186 4:153227968-153227990 CACTGGATTCTGCTTATGGAAGG + Intronic
985575588 5:672082-672104 ACCTGGGTCCTGCTCCTGGGAGG + Intronic
989256452 5:39370906-39370928 CCCTGGAACCTGCTTTTGTATGG + Intronic
992056153 5:72992825-72992847 ACCTGAAAACTGCTTGGGGATGG + Intronic
994773906 5:104019811-104019833 ATCTGGATCTTGTTTGTGCATGG - Intergenic
997398379 5:133582453-133582475 ACCAGGATGCTGTTTGTGGGTGG - Intronic
1002075333 5:176705136-176705158 TCCTGGAGCCTGGCTGTGGAGGG + Intergenic
1002094514 5:176823159-176823181 ATCTGGATGCTGCATGTGGGGGG + Intronic
1002639482 5:180623945-180623967 ACCTGGACCGAGTTTGTGGAGGG - Exonic
1002882362 6:1264134-1264156 AGCTGGATCCAACATGTGGACGG - Intergenic
1003234428 6:4282994-4283016 ACCTGGAGCCAGCTTATGGCAGG - Intergenic
1007059829 6:38927830-38927852 CCCAGGAACCTTCTTGTGGAAGG + Intronic
1007859887 6:44897733-44897755 ACCCAGACCCTGCTTCTGGAGGG + Intronic
1009462990 6:63936234-63936256 ACCTGGATCCTGATTGCTGGCGG + Intronic
1014447862 6:121549532-121549554 ACCTGGCTACTTCTTGTTGAAGG - Intergenic
1015409528 6:132877234-132877256 ACCTGGAGCTTGCCTGTGGTGGG + Intergenic
1015601620 6:134916253-134916275 CCCTGGGTCCTGCCTGCGGAGGG - Intergenic
1017128221 6:151085830-151085852 ACCTGGTCCCTGCTTGTAGAGGG - Intronic
1018812159 6:167306211-167306233 ATCTGATTCCTGCTTGTTGAGGG - Intronic
1018836157 6:167485705-167485727 ACATGGATGCTGGTTGAGGAAGG + Intergenic
1021798661 7:24283743-24283765 ACCTGAATCCTCTTTGTGGTGGG - Intergenic
1023417871 7:39949797-39949819 ACCAGGAGCCTCCTCGTGGAGGG + Intergenic
1024062367 7:45708614-45708636 CCCTGGAAGCTGCTGGTGGAAGG + Intronic
1024533228 7:50410008-50410030 AACTGGAACCTGCTGGGGGAGGG + Intergenic
1026260611 7:68752148-68752170 ACCTAGATCCTTCGTGTGCACGG - Intergenic
1026329543 7:69339709-69339731 ACCGGGTACCTGTTTGTGGAGGG + Intergenic
1031077601 7:117227865-117227887 ACCTGGCACCCGCTTGAGGATGG + Intronic
1032557223 7:132849142-132849164 GCCTGGTTTCTCCTTGTGGAAGG + Intronic
1035399456 7:158555366-158555388 CCGTGGATGCTGCTTGTGAAGGG - Intronic
1038436981 8:27543118-27543140 TCCTGGCTCCTGGTTGTGGGAGG + Intronic
1038996992 8:32934593-32934615 AACTGTATCCAGCTTCTGGAGGG - Intergenic
1041156366 8:54991205-54991227 CCCTGGTTCCTGGTTCTGGAGGG - Intergenic
1043587783 8:81789242-81789264 CACTGGATCCTACTTGTGGGTGG - Intergenic
1044515282 8:93130440-93130462 AAATGGATGCTGCATGTGGAAGG + Intergenic
1044533847 8:93337759-93337781 ACCTGGCTCCTCCATGTTGATGG + Intergenic
1046787186 8:118280621-118280643 GCCTGGAGCTTGCTTTTGGAAGG - Intronic
1047911894 8:129539304-129539326 GGCTGCCTCCTGCTTGTGGATGG - Intergenic
1048153684 8:131920061-131920083 AACTGGATTTTGCTTGGGGATGG + Intronic
1049402499 8:142435835-142435857 GCCTGGATCCTGGTTGTTGTGGG - Intergenic
1053037698 9:34839300-34839322 AACTGGTTGCTGCTTGTGGTTGG + Intergenic
1055990676 9:82102298-82102320 TCCTGCACCCTTCTTGTGGAGGG + Intergenic
1056367300 9:85918556-85918578 CCCTGGTTCCTGCCTGTAGAAGG - Intergenic
1057357073 9:94340687-94340709 GCCTGGATCCAGATTATGGATGG + Intergenic
1057650679 9:96916940-96916962 GCCTGGATCCAGATTATGGATGG - Intronic
1058612926 9:106794357-106794379 AGCTGGGTCCTGATTGTGAAAGG + Intergenic
1058823414 9:108753716-108753738 TCCTGGATCCTGCTTGTACAGGG - Intergenic
1059162234 9:112045970-112045992 AGGTAGATCCTGCTGGTGGATGG - Intronic
1062026238 9:134342031-134342053 AGCTGGAGCCTGCCTGTGGTGGG + Intronic
1189026227 X:37397763-37397785 AGGTGGAACCTGCTTGTAGAGGG + Intronic
1189032769 X:37466932-37466954 ACCTGGCTCCATCTTGAGGATGG + Intronic
1195564652 X:106326607-106326629 ACCTGGAGCATGTTTGGGGAAGG - Intergenic
1195595319 X:106682651-106682673 ACGTGGTTGCTGCTGGTGGATGG - Intergenic
1199991057 X:152988033-152988055 CCCTGGATGCTGCCTGAGGAGGG - Intergenic
1200972650 Y:9171924-9171946 CCCTGAATTCTGCTTCTGGAAGG - Intergenic
1202138368 Y:21692285-21692307 CCCTGAATCCTGCTTCTGGAAGG + Intergenic
1202232038 Y:22668465-22668487 AACTTGATCCTGGTTGTAGAAGG - Intergenic
1202311118 Y:23527693-23527715 AACTTGATCCTGGTTGTAGAAGG + Intergenic
1202559684 Y:26142901-26142923 AACTTGATCCTGGTTGTAGAAGG - Intergenic
1202592010 Y:26494800-26494822 ACCTTTATCCTGCTTATGCAAGG - Intergenic