ID: 966787728

View in Genome Browser
Species Human (GRCh38)
Location 3:183636048-183636070
Sequence GCGGCGCGGCTGGTGCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 1, 2: 1, 3: 42, 4: 320}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966787720_966787728 -1 Left 966787720 3:183636026-183636048 CCTGGCACTACGGCCCGGAACCG 0: 1
1: 0
2: 0
3: 2
4: 24
Right 966787728 3:183636048-183636070 GCGGCGCGGCTGGTGCGGCCTGG 0: 1
1: 1
2: 1
3: 42
4: 320
966787715_966787728 22 Left 966787715 3:183636003-183636025 CCTGAGGGAGGGCGCGCGCGCCT 0: 1
1: 0
2: 3
3: 13
4: 95
Right 966787728 3:183636048-183636070 GCGGCGCGGCTGGTGCGGCCTGG 0: 1
1: 1
2: 1
3: 42
4: 320
966787719_966787728 2 Left 966787719 3:183636023-183636045 CCTCCTGGCACTACGGCCCGGAA 0: 1
1: 0
2: 0
3: 4
4: 43
Right 966787728 3:183636048-183636070 GCGGCGCGGCTGGTGCGGCCTGG 0: 1
1: 1
2: 1
3: 42
4: 320
966787714_966787728 23 Left 966787714 3:183636002-183636024 CCCTGAGGGAGGGCGCGCGCGCC 0: 1
1: 0
2: 1
3: 3
4: 113
Right 966787728 3:183636048-183636070 GCGGCGCGGCTGGTGCGGCCTGG 0: 1
1: 1
2: 1
3: 42
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966787728 Original CRISPR GCGGCGCGGCTGGTGCGGCC TGG Intronic