ID: 966787910

View in Genome Browser
Species Human (GRCh38)
Location 3:183636732-183636754
Sequence CCCCCTTGAAGGTGATCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966787902_966787910 -4 Left 966787902 3:183636713-183636735 CCCTGGGCCATTCTTCCCGCCCC 0: 1
1: 2
2: 2
3: 15
4: 237
Right 966787910 3:183636732-183636754 CCCCCTTGAAGGTGATCTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 127
966787903_966787910 -5 Left 966787903 3:183636714-183636736 CCTGGGCCATTCTTCCCGCCCCC 0: 1
1: 0
2: 2
3: 17
4: 262
Right 966787910 3:183636732-183636754 CCCCCTTGAAGGTGATCTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 127
966787901_966787910 0 Left 966787901 3:183636709-183636731 CCTGCCCTGGGCCATTCTTCCCG 0: 1
1: 1
2: 2
3: 16
4: 221
Right 966787910 3:183636732-183636754 CCCCCTTGAAGGTGATCTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966787910 Original CRISPR CCCCCTTGAAGGTGATCTGG AGG Intronic
901511144 1:9718595-9718617 CCCCCTTGAATGTCCTCAGGTGG - Intronic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
904326439 1:29729661-29729683 CTGCCTGGAAGGTGACCTGGGGG + Intergenic
905919042 1:41707146-41707168 GCCCCTTGAAGGGGTTCTGCAGG + Intronic
905950263 1:41944963-41944985 CCCCCTTGAAGAGGATATTGTGG - Intronic
910590902 1:88927326-88927348 CCCCCTTGAAGAGGATATTGTGG - Intergenic
921196279 1:212760571-212760593 CCCCCCTAAATGTGCTCTGGGGG + Intronic
1069989952 10:72309139-72309161 GCCCTTCCAAGGTGATCTGGAGG + Intergenic
1071756286 10:88544155-88544177 ACACCTTGAAGAGGATCTGGTGG + Intronic
1072921206 10:99578751-99578773 ATCCATTCAAGGTGATCTGGGGG - Intergenic
1074001410 10:109377307-109377329 GCACCTTGAAGGTGATATGTTGG + Intergenic
1074348927 10:112716043-112716065 ACCCCTAGAAGGGGATCTAGTGG + Intronic
1075960990 10:126567608-126567630 AGCCCTGGAAGGTGACCTGGAGG + Intronic
1076614803 10:131748242-131748264 CCCACTGGAAGCTGATGTGGAGG + Intergenic
1078118528 11:8481158-8481180 AACCCTTGAAAGTGATCTTGAGG - Intronic
1078203884 11:9210841-9210863 GCCTCTTGAAGGTGATAGGGAGG + Intronic
1081679777 11:44994160-44994182 CCACCTGGAAGGTGAGCTGAGGG - Intergenic
1081710208 11:45211319-45211341 CCCCCAGGAAGGTGATGGGGAGG - Intronic
1081736170 11:45405994-45406016 CCTCCATGATGGTGAACTGGAGG - Intergenic
1084423385 11:69071636-69071658 CCCTCTTGAGGGGGAGCTGGGGG + Intronic
1087901174 11:103642959-103642981 CCTGCTTGAAGGTGATTTAGAGG - Intergenic
1090147271 11:124338994-124339016 CCTCCTTGGAGTTGATGTGGAGG + Intergenic
1091280087 11:134376758-134376780 GCCCCGTGAAGGTGGGCTGGGGG + Intronic
1097149793 12:56968266-56968288 CCCCCTTGAAGAGGATATCGCGG + Intergenic
1099862573 12:88238738-88238760 CCTGCCTGAAGGTGACCTGGTGG + Intergenic
1101529312 12:105559718-105559740 CTCCCTTGAAGCTGACCAGGTGG - Intergenic
1101650977 12:106676724-106676746 CCCTCTTGGAGATGTTCTGGTGG - Intronic
1104858578 12:131913187-131913209 TCCCCCTGCAGGTGACCTGGTGG + Exonic
1107875719 13:44789142-44789164 CCCACAAGAAGATGATCTGGAGG - Intergenic
1109931627 13:69224354-69224376 CCCCCTTGAAGAGGATATCGTGG - Intergenic
1111021825 13:82460214-82460236 CCCCCTTGAAGAGGATATCGTGG - Intergenic
1115246434 14:31300495-31300517 CTCCCTTGAAGGGGATCTCTCGG - Intronic
1118931653 14:70247508-70247530 TCCCCTTGAAGGTGATCAGCAGG - Intergenic
1118953511 14:70457630-70457652 TCCCCTTGAAGGTGATCAGCAGG + Exonic
1118960376 14:70524605-70524627 TCCCTTTGAAGGTGATCAGCAGG - Exonic
1119640121 14:76308602-76308624 CCCCCTTGAAGCTGGCCTGGGGG - Intergenic
1121112393 14:91321203-91321225 GCCCCTGGATGGTGCTCTGGAGG + Exonic
1121888329 14:97565100-97565122 CACACTTGAAGGGGATCTTGGGG + Intergenic
1122397336 14:101442580-101442602 CCTCCCTGAAGGAGATCCGGGGG - Intergenic
1127074425 15:55311704-55311726 CCCCCTTGAAGAGGATATCGTGG + Intronic
1131416880 15:92267610-92267632 CCTCCTGGGAGGTGAGCTGGAGG - Intergenic
1140490774 16:75334115-75334137 GGCCCTTGAAGATGATCTTGAGG - Intronic
1141878393 16:86841940-86841962 CCCACTTGAAGCTGAGCTGCGGG + Intergenic
1148476013 17:47929151-47929173 GGCCCTTGGAGGTGCTCTGGGGG - Intergenic
1148522935 17:48299435-48299457 CCCCCTTCAATGATATCTGGAGG - Intronic
1149285560 17:55160485-55160507 TGCCCGTGAAGCTGATCTGGTGG + Exonic
1150318662 17:64191337-64191359 CTCTTTTGAAGGTGCTCTGGGGG + Intronic
1153984612 18:10341147-10341169 CCACCTTGCAGGTGGGCTGGGGG + Intergenic
1161888051 19:7012147-7012169 CCCCCTTCAAGGAGAATTGGAGG - Intergenic
1163372359 19:16908482-16908504 CTCCCTAGAATGTGATCTGTTGG + Intronic
1166960942 19:46495473-46495495 CCCCCTTGGCGCTGATCTTGGGG + Exonic
1167471932 19:49680266-49680288 TCCCCTGGATGGTGCTCTGGGGG + Intronic
1168385579 19:55960379-55960401 GCCCCTTGAATGTGATTTTGTGG - Intronic
925834826 2:7934339-7934361 GCCTCTTGAAGGTGCTTTGGGGG - Intergenic
926734186 2:16060085-16060107 CCCCATTAATGGTGAGCTGGGGG - Intergenic
929336587 2:40754996-40755018 CCCCTTTGCAGGTGAAATGGTGG - Intergenic
936171513 2:110180947-110180969 CCCCCTTGCTGGGGATCTTGGGG - Intronic
937086503 2:119175253-119175275 CCCTCTGGGAGGTGATCTGCAGG - Intergenic
943092557 2:183391890-183391912 TCCCCTTAAAGGTGTTCTTGTGG - Intergenic
944331206 2:198468460-198468482 CCCCCTTGAAGGAGAGAAGGTGG - Intronic
945306137 2:208260682-208260704 CCCCCTAGAAAATGATTTGGTGG - Intronic
948085157 2:235241273-235241295 CACCCTTGACGTTGATCTGCTGG - Intergenic
948676646 2:239600861-239600883 CCCCTCTGAAGGTGAGCGGGCGG - Intergenic
1170414790 20:16128017-16128039 TCCACTTAAAGGTGATCTTGGGG - Intergenic
1170874041 20:20234280-20234302 ACCCCTTGCAGGTGAGCAGGTGG + Intronic
1172598618 20:36168135-36168157 GCCCCTGGAAGGTGAGCTAGAGG + Intronic
1173840098 20:46151571-46151593 CCCCCTTGGAGGTGATTTTCAGG - Intergenic
1174625772 20:51913049-51913071 CCCCAATGAAGGTGATTTGAAGG - Intergenic
1176088171 20:63307413-63307435 CCCCGGGGTAGGTGATCTGGGGG + Intronic
1177896125 21:26857497-26857519 CCCCCTTGAAGAGGATATCGTGG - Intergenic
1179980288 21:44891981-44892003 TCACCTGGAAGGTGATCTGCAGG + Exonic
1184448596 22:44569586-44569608 CTCCACTGCAGGTGATCTGGCGG + Intergenic
1185110620 22:48898223-48898245 CCATCTTGCAGGAGATCTGGGGG - Intergenic
950100469 3:10353494-10353516 CCACGCTGCAGGTGATCTGGAGG + Intronic
951200813 3:19873976-19873998 CCCCCTTGAAGAGGATATTGTGG + Intergenic
951837745 3:27001719-27001741 CCCCCTTGAAGAGGATATCGTGG - Intergenic
954466909 3:50660660-50660682 CCCCCTTGGATGTGGCCTGGAGG - Intergenic
955337231 3:58096840-58096862 TCTCCTTGGAGGTGCTCTGGAGG + Intronic
955403240 3:58608688-58608710 CCCCCTTGGAGGTGGCATGGGGG + Intronic
961834510 3:129645656-129645678 CCCCCTCTAAGGCAATCTGGAGG + Intergenic
962067318 3:131995380-131995402 CCCCCTTCAAGGTTCTGTGGAGG + Intronic
963187815 3:142438689-142438711 CCCCCTTGAAGAGGATATCGTGG - Intronic
966787910 3:183636732-183636754 CCCCCTTGAAGGTGATCTGGAGG + Intronic
969216089 4:5723525-5723547 CCCCCTTGAAGGTCAACTCCTGG + Intronic
971487263 4:27172791-27172813 CCTCCTGGCAGGTGATGTGGTGG + Intergenic
972331288 4:38066689-38066711 CCCCCCTGGAGGGGAGCTGGGGG + Intronic
975733074 4:77356419-77356441 CCTTGTTGAAGGGGATCTGGTGG + Intronic
978586931 4:110283765-110283787 CCCCCTTGAAGAGGATATCGTGG + Intergenic
980078334 4:128317893-128317915 CCCCCTTTAGGGTATTCTGGTGG - Intergenic
980696090 4:136357365-136357387 CAACCTTGAAGCTGATCTGAGGG + Intergenic
984723623 4:182999821-182999843 CCCCCTTGAAGAGGATATCGTGG - Intergenic
984878303 4:184388925-184388947 CCTCTTTGATGGTGACCTGGAGG + Exonic
986201719 5:5585099-5585121 ACCCCTTGGTGGTGATGTGGGGG + Intergenic
988957299 5:36332422-36332444 CCCCCTTGAAGAGGATATCGTGG + Intergenic
991443574 5:66676977-66676999 CCTTTTTGAAGGTCATCTGGTGG + Intronic
997605189 5:135170202-135170224 CCCCCTCGAAGGAGAACTGCAGG - Intronic
998216686 5:140242963-140242985 CCCCCCTGGAGGGGAACTGGGGG - Intronic
1005245522 6:23880034-23880056 CTCCATTTAAGATGATCTGGGGG - Intergenic
1006314259 6:33280713-33280735 CCCCTTTGAAGATGTGCTGGGGG - Exonic
1007717376 6:43865124-43865146 CCCTCGGGAAGGTGGTCTGGTGG + Intergenic
1008788784 6:55203465-55203487 CCCCAGTGAAGGTGATCTCCAGG - Intronic
1011497459 6:87950549-87950571 CCACCATCAAGGTGATGTGGTGG - Intergenic
1017206961 6:151813344-151813366 CCCGCTTGTAAGTGATGTGGTGG + Intronic
1018760915 6:166893702-166893724 CCCCCTTGAAGAGGATATCGTGG - Intronic
1019089483 6:169516453-169516475 CCCCCCTGGAGGAGTTCTGGAGG - Intronic
1020394404 7:7697915-7697937 CCCTCATGAAGGTGAGCTGAGGG - Intronic
1023177626 7:37448738-37448760 CACCATTGAAGGGGAACTGGAGG + Exonic
1024326492 7:48113476-48113498 CACCCTTCAAGGAGATCTGGGGG - Intergenic
1025728206 7:64087442-64087464 CCTCCTAGAATGTGATCTCGGGG - Intronic
1030176467 7:106660351-106660373 GCACCTTGGAGGAGATCTGGAGG - Exonic
1030337170 7:108339923-108339945 CCCCCTTGAAGAGGATATTGTGG - Intronic
1030843617 7:114383649-114383671 CCCCCTTGAAGAGGATATCGTGG + Intronic
1031471405 7:122173137-122173159 CCCCCTTGAAGAGGATATAGTGG - Intergenic
1032263577 7:130355130-130355152 CCCCATTAATGGTCATCTGGGGG - Intronic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1033283790 7:140023916-140023938 CCACCTGGCAGGTGACCTGGAGG - Exonic
1033295590 7:140131288-140131310 CCCCATTGGAAGAGATCTGGTGG - Intronic
1038823615 8:30976622-30976644 CTCCCTTAAAAGTGATTTGGAGG - Intergenic
1041166339 8:55096359-55096381 CCGCCTTGAAGGTGGCCTAGAGG - Intergenic
1049196043 8:141316207-141316229 CCCCCTTGAAGGGGACTTTGAGG + Intergenic
1049388231 8:142354934-142354956 CCACCTTGAAGGGGCTCTGTGGG - Intronic
1049390140 8:142363515-142363537 CCACCTTGAAGGGGCTCTGTGGG - Intronic
1051360006 9:16273794-16273816 CCCCCTTGAATGTGGGCAGGTGG + Intronic
1054741852 9:68814049-68814071 CCACCTTGATGGGGAGCTGGAGG + Intronic
1057258940 9:93573471-93573493 CCCCTGAGAAGGTGAGCTGGGGG - Intergenic
1059809653 9:117841563-117841585 TTTCCTTGAAGGGGATCTGGGGG - Intergenic
1060602644 9:124888385-124888407 CCACCTTGTAGGTGACCTCGAGG - Exonic
1185927066 X:4158883-4158905 CCCCCTGAAAGGTGATCTCCTGG - Intergenic
1189377446 X:40476568-40476590 CTTCCTTGAAAGTGACCTGGTGG + Intergenic
1190879070 X:54479828-54479850 GCCCCTTGAATGTGAACTGCAGG + Intronic
1194383419 X:93223133-93223155 CCCCCGTCAAGGTGATCTTCTGG - Intergenic
1194413838 X:93586410-93586432 CCCCCTGGAAGGTCTTCAGGGGG + Intergenic