ID: 966800526

View in Genome Browser
Species Human (GRCh38)
Location 3:183759660-183759682
Sequence TAAGTTGGACCACTGTAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966800526_966800529 0 Left 966800526 3:183759660-183759682 CCACCTTACAGTGGTCCAACTTA 0: 1
1: 0
2: 5
3: 41
4: 165
Right 966800529 3:183759683-183759705 ACGATTTTTCGACTTTACCGTGG 0: 1
1: 3
2: 13
3: 71
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966800526 Original CRISPR TAAGTTGGACCACTGTAAGG TGG (reversed) Intronic
901520755 1:9783184-9783206 TAAGTTGAGCCACTGTAAGTGGG - Intronic
902065540 1:13682700-13682722 TAAATCGAACCACTGTAAGTGGG - Intergenic
902724858 1:18328472-18328494 TAAGTTGAACCATTGTGAGTCGG + Intronic
905350206 1:37340289-37340311 TAAGTTGAACCCTTGTAAGTTGG - Intergenic
905784305 1:40741158-40741180 TAAGTTGAATCATTGTAAGTAGG - Intronic
906091445 1:43182883-43182905 TAAGTTGAACCATAGTAAGTTGG - Intronic
906514088 1:46428759-46428781 TAAGTTGAACCATGGTAAGTTGG + Intergenic
907015833 1:51012079-51012101 TAAGTCGGACCATTGCAAGTTGG - Intergenic
907067329 1:51498331-51498353 TAAGTTGAACCATTGTAAATTGG - Intronic
908619524 1:65962285-65962307 TCAGTTGAACCATTGTAAGTTGG + Intronic
910350284 1:86288601-86288623 TAAGTTAAACCACTGTAAGGGGG - Intergenic
913347581 1:117824071-117824093 TAAGTTGGAGCTCTGGAAGAAGG - Intergenic
915159831 1:153910283-153910305 TAAGTTGAGCCATTGTAAGTTGG - Intronic
918489381 1:185064424-185064446 TAAGTCGAACCACTGTAAATTGG - Intronic
920510347 1:206546886-206546908 TAAGTAGGACCGTTGTAAGGAGG + Intronic
923549500 1:234951604-234951626 TAAGTTGAACCACTGTAAGTTGG - Intergenic
924954728 1:248915289-248915311 TAAGTTGAACCACGCTAAGTGGG - Intronic
1065162874 10:22941372-22941394 TAAATTGGCCCTCTGTAAGCTGG + Intronic
1065567422 10:27027753-27027775 TAAGTTGGGCTATTGTAAGTTGG - Intronic
1065741824 10:28803884-28803906 TAAGTTGGACCACTGAAGTAGGG - Intergenic
1065892218 10:30131103-30131125 TAAGTTGGACCACAATAACTTGG + Intergenic
1068268422 10:54685905-54685927 TAAATTGAACCACTGTAAGTTGG + Intronic
1070009845 10:72462138-72462160 TAAGTGGGACCATTGTAAGTTGG - Intronic
1070527431 10:77307304-77307326 TAAGTTGAGCCATTGTAAGTTGG - Intronic
1071578643 10:86750050-86750072 TAGGTTGCACAACTTTAAGGGGG - Intergenic
1073525319 10:104175814-104175836 TAAGTTGAACCACTGTGAGTTGG + Intronic
1076266895 10:129115682-129115704 TATGTTGAACCACTGTAAGTGGG - Intergenic
1081470062 11:43361664-43361686 TAAGTTGAACCATCGAAAGGTGG + Intronic
1082781157 11:57288402-57288424 TACGCTGAACCACTGTAAGTTGG - Intergenic
1087115611 11:94521254-94521276 TAAGTTGAACCACAATAAGTTGG - Intergenic
1088306051 11:108409420-108409442 TAAGTTGAACCACTTTAAGTCGG - Intronic
1089958571 11:122595794-122595816 GAGGTTAGAACACTGTAAGGTGG + Intergenic
1090348961 11:126094632-126094654 TAAGTTGGACCTGTCTAAGCAGG - Intergenic
1090675102 11:128984945-128984967 TAAATTGAACCATTGTAAGTTGG - Intronic
1091556014 12:1574110-1574132 TAATTGGGACCACTGTAATGGGG + Intronic
1092685902 12:11045848-11045870 TAAGTTGGAATACTGAAATGTGG + Intronic
1093922594 12:24876189-24876211 TAAGTAGGACCATCGTAAGTTGG + Intronic
1096343605 12:50825270-50825292 TAAGTTGAACCATTGTAAGTTGG + Intergenic
1097780294 12:63695474-63695496 TAAGTTGAACCATTGCAAGTTGG - Intergenic
1099485090 12:83219655-83219677 TAAATTGAACCACTGTAAATTGG + Intergenic
1099518333 12:83627205-83627227 TAAGTTGAACCATTATAAGTCGG - Intergenic
1099778959 12:87170288-87170310 TATCTTGGGCCACTGGAAGGTGG + Intergenic
1100774811 12:97962453-97962475 TAAGCTGAACCATTGTAAGTTGG + Intergenic
1105801985 13:23914018-23914040 CAAGTTGAACCATTGTAAGTTGG + Intergenic
1106068178 13:26379415-26379437 TAAGTTTGACCACTGGTGGGGGG - Intronic
1111237129 13:85423738-85423760 TAAGGTGCAGCACTTTAAGGGGG + Intergenic
1115019430 14:28657957-28657979 TAAATTGAACCACTGTAAGTTGG - Intergenic
1115480576 14:33857411-33857433 TAAATTGAACCACTGTAAGTAGG - Intergenic
1116461662 14:45183048-45183070 TAAGTTGAACCATCGTAAGTTGG + Intronic
1117542313 14:56760249-56760271 TAAGGAGAACCACAGTAAGGGGG - Intergenic
1120236146 14:81893495-81893517 AAAGTTGGCACACAGTAAGGAGG - Intergenic
1120328206 14:83055225-83055247 TATTTTAGTCCACTGTAAGGTGG - Intergenic
1121392599 14:93589154-93589176 TAAGTTGGTCCACTGCAAACTGG - Intronic
1121938963 14:98049325-98049347 TAAGTTGGATTACTAAAAGGCGG - Intergenic
1122377635 14:101276037-101276059 TAAGTTGAATCATTGTAAGTTGG - Intergenic
1124117648 15:26861918-26861940 TAAGTTGAGCCATTGTAAGTTGG + Intronic
1124928260 15:34093458-34093480 TAAGTTGAACCATTGTAAGCTGG + Intronic
1125029928 15:35066078-35066100 TAAGTCTGACCTCTGTAAAGAGG - Intergenic
1125529660 15:40404637-40404659 TAAGTTGAACTATTGTAAGTTGG - Intergenic
1126971007 15:54111759-54111781 TAAGCAGGACCACTCCAAGGGGG + Intronic
1128790850 15:70432712-70432734 TAAGTTGAACCATTGTAAGTTGG + Intergenic
1132168744 15:99624915-99624937 TAAGTCAAACCACTGTAAGTTGG - Intronic
1134429932 16:14193896-14193918 TAAGTTGAACCACTGTAAGCAGG - Intronic
1135292959 16:21255908-21255930 TAAGTTGAACGATTGTAAGTGGG - Intronic
1138164944 16:54792502-54792524 TAAGTTGGACAAATGAGAGGGGG + Intergenic
1139331695 16:66197202-66197224 TAAGCTGAACCATTGTAAGTTGG - Intergenic
1140432927 16:74920165-74920187 TAAGTTGAACCATTGTAAATTGG - Intronic
1140696991 16:77544622-77544644 TCAGTTGGAGCAATGTAAGAGGG - Intergenic
1146762756 17:35492593-35492615 TAAGTTGGACCAAGGGAAGTTGG + Intronic
1147510270 17:41062588-41062610 TAAGTTAGACAACTGCAAAGAGG - Intergenic
1147609961 17:41796074-41796096 TAAGTTGAATCATTGTAAGCTGG + Intergenic
1203182833 17_KI270729v1_random:80424-80446 GAAATTGGGCCTCTGTAAGGTGG - Intergenic
1203190773 17_KI270729v1_random:185881-185903 GAAATTGGGCCTCTGTAAGGTGG - Intergenic
1153021830 18:636262-636284 TAAGTTGAACCATTGTAAATTGG + Intronic
1155367214 18:25060573-25060595 TAAGCTGAACCATTGTAAGTTGG + Intergenic
1155649596 18:28125221-28125243 TAAATTGAACCATTGTAAGCCGG + Intronic
1156993120 18:43434372-43434394 TAAATTGGACCACAGTGAGCAGG - Intergenic
1157889114 18:51397555-51397577 TAAGTTAAACCACAGTAAGTTGG - Intergenic
1158828639 18:61253535-61253557 TGAGTTGAACCATTGTAAGCTGG - Intergenic
1161993361 19:7697949-7697971 TAAGTTGAGCCATTGTAAGTTGG - Intronic
1163088338 19:14999686-14999708 CAAGTTGAACCATTGTAAGTTGG - Intronic
926932697 2:18056245-18056267 TGAGTTGGACCAGAATAAGGTGG - Intronic
927122647 2:19982022-19982044 TAAGTAGTACCATTGTAAGTTGG - Intronic
928136393 2:28691115-28691137 TAAGTTGAACCACCATAAGTCGG + Intergenic
928727183 2:34188204-34188226 TAAGTTGAACCATCGTAAGTTGG + Intergenic
930087100 2:47505288-47505310 CAAGTTGAACCACTGTAAGTTGG - Intronic
930463296 2:51711532-51711554 TAAGTTCTACCACTGTAAGATGG - Intergenic
930827909 2:55712827-55712849 TCAGTTTGACCTCTGGAAGGAGG + Intergenic
931080067 2:58758977-58758999 TAGGTTGAACCATTGTAAGTTGG - Intergenic
932127663 2:69158535-69158557 TAAGTTGAACCACCATAAGTTGG - Intronic
933872753 2:86585275-86585297 TAAGTTGAACCATTGTAAGTTGG - Intronic
935254003 2:101292204-101292226 TAAGTTAAACCATTGGAAGGTGG + Intronic
936232583 2:110716094-110716116 GATGTTGGACAACTGGAAGGAGG + Intergenic
936641010 2:114312923-114312945 AAAGATGGCCCACTGTAAGTGGG + Intergenic
938751783 2:134338580-134338602 TAAGTGGGAGCATTGTAAGTGGG - Intronic
939170086 2:138685739-138685761 TAAGTTGAACCAAAGTAAGCTGG + Intronic
939245793 2:139621833-139621855 TAAGCTGAACCATTGTAAGTTGG - Intergenic
942069393 2:172302292-172302314 TAAGTCAAACCACTGTAAGTTGG - Intergenic
944942715 2:204647089-204647111 TAAGTTAAACCACTGTAAGTTGG + Intronic
945848937 2:214982321-214982343 AGAGTTGGAACACTGTCAGGAGG - Exonic
946556277 2:220861187-220861209 TAAGTTGAACCATTGTGAGAAGG - Intergenic
947847432 2:233256656-233256678 TAAGTCGAACCACTGCAAGTTGG - Intronic
1169985518 20:11439304-11439326 TAAGTTGAACCATAGTAAGTTGG - Intergenic
1170980933 20:21212318-21212340 TAAGTTGAACCATTGTAAGTTGG - Intronic
1171024589 20:21617716-21617738 TAAGTTGAACAATTGTAAGTTGG + Intergenic
1173970164 20:47146435-47146457 GAAGTTGCACCTCTGGAAGGAGG + Intronic
1174613315 20:51816937-51816959 TAAATTGAACCATTGTAAGTTGG + Intergenic
1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG + Intronic
1178675511 21:34628146-34628168 TCAGTTGTACCTCAGTAAGGTGG - Intergenic
1181624159 22:24111775-24111797 TAAGTTGAACCATTGTAAGTTGG + Intronic
950409506 3:12826097-12826119 AAAGTTGAACCATTGTAAGGCGG - Intronic
952253168 3:31673646-31673668 TAAGTTGAACCACAGTAAGTTGG - Intronic
953121079 3:40043100-40043122 TAAGTTGAACCATTATAAGTGGG + Intronic
953338806 3:42116828-42116850 AAAGATGGACCTCTGTATGGTGG + Intronic
956346880 3:68289304-68289326 TAAGTTGGACCACATTAAAATGG - Intronic
957225080 3:77432859-77432881 GAAGTTGTACCACTGTCTGGAGG - Intronic
957262791 3:77922389-77922411 TAAGGGAGACCACTGCAAGGTGG + Intergenic
957590243 3:82187436-82187458 TAAGTTGAACCATGGTAAGTCGG + Intergenic
958665050 3:97126860-97126882 GAAGATGGACCAATGGAAGGAGG + Intronic
958682911 3:97353695-97353717 AAAGTTGCACCCCTGAAAGGAGG + Intronic
959126703 3:102298577-102298599 TAAGTTGAACCATCGTAAGTTGG - Intronic
960199846 3:114818989-114819011 TAAGCTGAACCACTGTAAGTTGG - Intronic
960878366 3:122319151-122319173 CAAGTTGAACCACTGTAAGTTGG - Intergenic
961960878 3:130853936-130853958 TAATTTGGACCACAGAAAAGGGG - Intronic
962391946 3:134979600-134979622 TAAGTTGAACCATTGTAAGTTGG - Intronic
963436126 3:145269059-145269081 TAAGTTGGACCATTGCAAGTTGG - Intergenic
964462307 3:156947525-156947547 TAAGTTGAATCATGGTAAGGTGG - Intronic
964968468 3:162528581-162528603 TAAGTTGAACCATGGTAAGTCGG - Intergenic
966760785 3:183417400-183417422 TAAGTTGAATCATTGTAAGCTGG + Intronic
966800526 3:183759660-183759682 TAAGTTGGACCACTGTAAGGTGG - Intronic
967405450 3:189111398-189111420 TAAGTTGGACCATTATAAGTAGG - Intronic
967523300 3:190461883-190461905 TAAATTGAACCATTGTAAGTCGG + Intergenic
967565050 3:190962848-190962870 CAAGTAGGAACACTGTATGGGGG - Intergenic
969461159 4:7329707-7329729 TAAGTTGAGCCATTGTAAGTTGG - Intronic
970091691 4:12415742-12415764 TAAGTTGAGCCACTGTAAGTTGG - Intergenic
970640813 4:18064086-18064108 TCAGTTTGACCACTGTGAGGAGG + Intergenic
972201571 4:36719335-36719357 TAAGCTGTACCACTGAAAGCAGG + Intergenic
972851078 4:43051656-43051678 TAAGTTGAACCATTGTAAGTGGG - Intergenic
975690875 4:76961790-76961812 TAAGTTGAACCATTGTAACTGGG + Intronic
978374921 4:108065140-108065162 AAAATTAGACCACTGTAAGTGGG - Intronic
981092873 4:140750836-140750858 TAAGTCGAACCATTGTAAGTTGG - Intronic
984470150 4:180159065-180159087 TAAGTTAGATCAGTGTTAGGAGG - Intergenic
986829802 5:11563467-11563489 TAAGTTGGACTAATTGAAGGTGG - Intronic
988801661 5:34701609-34701631 TCAGTTTGACAACTGTAAGGCGG - Intronic
989441403 5:41476152-41476174 TAAGCTGAACCATTGTAAGTTGG + Intronic
990426002 5:55689733-55689755 TAAGTTGAACTGCTGTAAGTTGG - Intronic
990856949 5:60279187-60279209 CCAGTTGGAACACTGTAATGAGG + Intronic
991145246 5:63295288-63295310 TACGTTGGACCACTTAGAGGAGG + Intergenic
992883755 5:81137057-81137079 TAAGTTGAGCCATTGTAAGTAGG - Intronic
993385826 5:87262040-87262062 TAAGTGGAACCATTGTAAGTTGG - Intergenic
994986037 5:106934983-106935005 TAAGTTGAACCATTGTAAGTAGG + Intergenic
995563184 5:113405196-113405218 TAAGCTGATCTACTGTAAGGAGG - Intronic
996340511 5:122433769-122433791 TAAGTTGAACCATTTTAAGTTGG - Intronic
996959364 5:129227236-129227258 TAAGTTGAACCACTGCAAGTTGG - Intergenic
997625963 5:135330717-135330739 TCAGGTGGATCACTGGAAGGCGG + Intronic
999045289 5:148460891-148460913 TAAGTTGGACCATCATAAGTTGG + Intronic
1001643099 5:173259402-173259424 TAAGTTGAGCCATTGTAAGTCGG + Intergenic
1001957416 5:175857725-175857747 TAAGTGGAACCATTGTAAGTTGG + Intronic
1002154998 5:177270559-177270581 TAAGTTGGACCATTCTGAGTTGG - Intronic
1004934245 6:20491785-20491807 TAAGTTGGACCAAGGGAAGTCGG + Exonic
1004974315 6:20947892-20947914 TAAGTTGAGCCATTGTAAGTCGG + Intronic
1005291815 6:24387079-24387101 TAAGTCGAATCACTGTAAGCTGG + Intergenic
1006202084 6:32302812-32302834 TAAGTTGGACCACATAAAGGTGG - Intronic
1007053170 6:38853980-38854002 TAAGTTGTACCATTGAAAGTTGG + Intronic
1007937394 6:45745189-45745211 TAAGTTGAACCATTGTAAAACGG - Intergenic
1008534143 6:52494213-52494235 TAAGTTGGACCATTGAAAGTTGG + Exonic
1009444517 6:63725412-63725434 TAAGTGGGACCTATGTAAGAGGG - Intronic
1011279137 6:85659546-85659568 TAAGTTGAACCATTGTAAGTTGG + Intergenic
1014505688 6:122251995-122252017 CAAGTTGAACCCCTGTAAGTTGG - Intergenic
1017268125 6:152475527-152475549 TAAGTTGAATCACTATAAGTTGG + Intronic
1017890798 6:158637482-158637504 TAAGTTGAGCCACTGTCAGCTGG + Intronic
1018404779 6:163467784-163467806 TAAGTCAGACCATTGTAAGTTGG - Intronic
1019857294 7:3621868-3621890 TAAGTTGAACCATCGTAAGTTGG - Intronic
1022008213 7:26286614-26286636 TAAATTGGATCACTGTAGAGAGG + Intergenic
1022938872 7:35211549-35211571 TAAGTTGAACCATTGCAAGTTGG - Intronic
1024584352 7:50828380-50828402 TAAGTTGAACCATCGTAAGTTGG + Intergenic
1026080200 7:67211253-67211275 CAAGTTGAACCACTGTAAGTTGG - Intronic
1026696888 7:72602750-72602772 TAAGTTGAACCACTGTAAGTTGG + Intronic
1027631848 7:80616391-80616413 TAAGTTGAATCATTGTAAGTTGG + Intronic
1029187367 7:98748768-98748790 TAAGTTGAGCCACTGTGAAGTGG - Intergenic
1029252483 7:99246865-99246887 TAACTTGAACCATTGTAAGTTGG - Intergenic
1031160835 7:118165879-118165901 TAAGTTGAACCATTTTAAGTTGG + Intergenic
1031421665 7:121559730-121559752 TAAGTCCAACCACTGTAAGTTGG + Intergenic
1031503199 7:122547410-122547432 TAATTGGTACCACTGTAAGGTGG - Intronic
1037511993 8:19592894-19592916 TAATTTGAACCACTGTAGTGGGG - Intronic
1038367965 8:26956300-26956322 TAAGTCGAACCATTGTAAGTTGG - Intergenic
1039066775 8:33615642-33615664 TACGTTGAACCATTGTAAGTTGG + Intergenic
1041611265 8:59852306-59852328 TAAGTTGAACCATTGTAAATTGG - Intergenic
1042298474 8:67249169-67249191 TAAGTTGAACCATTGTAAGTTGG - Intronic
1042883501 8:73521549-73521571 TAAGTTGAATCATTGTAAGTTGG - Intronic
1043393732 8:79816401-79816423 TAAGTTGAACCACTGTAAGTTGG - Intergenic
1043770707 8:84196237-84196259 TAAGTTGTACCACTGTCCAGTGG - Intronic
1044118652 8:88366404-88366426 TGAGTTGTAGCACTGTAAAGAGG + Intergenic
1046927768 8:119811132-119811154 TAAGTTGCATTTCTGTAAGGAGG - Intronic
1047010945 8:120671931-120671953 TAAGTCGAACCACTATAAGTTGG - Intronic
1047269250 8:123339495-123339517 TAAATTGAACCATTGTAAGTTGG - Intronic
1051028964 9:12650911-12650933 TAAGTTGGGCTACTATAAGCTGG - Intergenic
1051065554 9:13098183-13098205 TAAATTGGAGAAATGTAAGGTGG - Intergenic
1053439126 9:38100843-38100865 TAAGTTGAGCCATTGTAAGCTGG + Intergenic
1055191954 9:73535715-73535737 TAAGTTGAAGCATTGTAAGTTGG - Intergenic
1056700283 9:88898942-88898964 TAAGTTGAACCATTGTAAATTGG + Intergenic
1057348595 9:94275314-94275336 TAAGTTGAACCATTGTAAGTTGG + Intronic
1061577015 9:131513668-131513690 TAAGCTTGACCACTTTAAGGAGG - Intronic
1187513848 X:19947490-19947512 TAAGTTAAACCATTGTAAGTTGG - Intronic
1187732184 X:22266631-22266653 TAAGTTGTACCATTTTAAGTTGG - Intergenic
1188675145 X:32930300-32930322 TAAGTTGAACTACTGTATGTCGG + Intronic
1190124818 X:47694890-47694912 TAAGTTGAACCATTCTAAGCCGG + Intergenic
1190704539 X:53015926-53015948 TAAGTTGAACCATTTTAAGTCGG + Intergenic
1190805508 X:53832264-53832286 TGAGCTGGCCCAGTGTAAGGGGG + Intergenic
1194821895 X:98519049-98519071 CAAGTTGAACCATTGTAAGCTGG + Intergenic
1196376325 X:115036766-115036788 TAAATTGAACCATTGTAAGTTGG - Intergenic
1197311078 X:124906350-124906372 TAAGTTGAACCATTGTAAGTTGG + Intronic