ID: 966805073

View in Genome Browser
Species Human (GRCh38)
Location 3:183800747-183800769
Sequence TACAGTGATGTGACTAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966805071_966805073 10 Left 966805071 3:183800714-183800736 CCACTTGATGCACAGCTGAGGGT 0: 1
1: 0
2: 0
3: 17
4: 350
Right 966805073 3:183800747-183800769 TACAGTGATGTGACTAGAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966805073 Original CRISPR TACAGTGATGTGACTAGAGG TGG Intronic
900679578 1:3909236-3909258 TCCAGTGATGTGACTTAGGGTGG - Intergenic
901343139 1:8513458-8513480 CACAGTGATGTAACTAGAAAAGG + Intronic
904919754 1:33997831-33997853 TTCAGTAATGTGACTAGTGATGG + Intronic
905474377 1:38215507-38215529 CACAGTGATGGGCCTAGAGTAGG - Intergenic
907128936 1:52077702-52077724 TACATTTTTGTGGCTAGAGGAGG - Intronic
907645582 1:56239592-56239614 GACAGTGATGTTCCAAGAGGGGG + Intergenic
908042417 1:60128816-60128838 TACACTGATTTGACTAGTGGTGG + Intergenic
908435584 1:64102469-64102491 TACATTGATGTGTCCAGAGAGGG + Intronic
913065133 1:115244562-115244584 TACAATGATGTGTCTAGGTGTGG - Intergenic
916073425 1:161185732-161185754 TACAGAAATGAGACTAGAGATGG + Exonic
918327228 1:183421492-183421514 TAAAGTCATGGGACTAGATGAGG + Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
1063704498 10:8417806-8417828 TACAGTCATGTGTCTAGATGAGG - Intergenic
1064513908 10:16125298-16125320 GACAGTGATGTGACTAGCATTGG + Intergenic
1065065331 10:21957303-21957325 TAAAGTTAAGTGAATAGAGGAGG - Intronic
1066546665 10:36507522-36507544 TACAGCAATGTGATTAGAGTGGG - Intergenic
1067004976 10:42652037-42652059 TACAGTTGTGTGACTAGAGCAGG - Intergenic
1068301569 10:55148985-55149007 TACATTGATGTGAATATAGCAGG - Intronic
1071063436 10:81601701-81601723 TACAGTGAGTTGAGTAGATGTGG + Intergenic
1071300395 10:84252128-84252150 TTCAGGGAAGGGACTAGAGGAGG + Intronic
1073885728 10:108037496-108037518 TCCAGTCATGTGACTAAAGATGG - Intergenic
1075631820 10:124005085-124005107 CACTGTGATGTGAATTGAGGAGG + Intergenic
1076155947 10:128206130-128206152 TCCAGTGATGGGACTAGGGGCGG + Intergenic
1077155469 11:1089089-1089111 TACGGTCATGTGACCAAAGGAGG - Intergenic
1077417277 11:2430435-2430457 TACAGTGGTGATACTAGTGGTGG + Intergenic
1077822078 11:5755555-5755577 TACAATGATGTGGCAAGAAGGGG - Exonic
1080163762 11:29212035-29212057 TTCATTGATGTGACTATAGTTGG + Intergenic
1084158880 11:67333570-67333592 TCCTGTGATCTGACAAGAGGTGG - Intronic
1087041152 11:93801405-93801427 TACAGTAATGGGTCTAGATGTGG + Intronic
1090592435 11:128286808-128286830 CAGAGTGATGTGACTGAAGGTGG - Intergenic
1091034487 11:132220992-132221014 TACAGCGGTGTGACTCGAGGAGG - Intronic
1092005449 12:5065768-5065790 TACAGTCATGTGACTAGTTCTGG - Intergenic
1092140083 12:6177885-6177907 TACAGTGATGGGGGTAGAAGTGG + Intergenic
1095861456 12:46922477-46922499 AACAGTGATGAGAGTAGAGAAGG - Intergenic
1096087098 12:48872734-48872756 CAAAGTGCTGTGATTAGAGGTGG + Intergenic
1096669241 12:53188637-53188659 TACAGTGATAGGACTTGGGGAGG - Exonic
1099536137 12:83847089-83847111 TACAATGATATGCCTAGGGGTGG + Intergenic
1105271156 13:18875926-18875948 TACAGGGAGGTGATTGGAGGGGG - Intergenic
1106687545 13:32077021-32077043 TACGGAGATGAGACTAGAAGTGG + Intronic
1108628438 13:52255585-52255607 TACAGAGAAGTGCCTAAAGGAGG + Intergenic
1110636905 13:77776927-77776949 TGCAGTCATGTGACTGGTGGTGG - Intergenic
1112134945 13:96567279-96567301 TACAGTGATGTGATTATGAGTGG - Intronic
1113108425 13:106796362-106796384 TACAGTGAAATGAACAGAGGAGG - Intergenic
1115025509 14:28740543-28740565 TATTGTGATGTGACTACATGTGG + Intergenic
1115386116 14:32799114-32799136 GACAGAGAAGTGAATAGAGGAGG + Intronic
1121570100 14:94940860-94940882 TACAGTGCTGTGATGAGTGGGGG - Intergenic
1123871303 15:24576982-24577004 TATAATGATGTTATTAGAGGAGG + Intergenic
1126479918 15:49106843-49106865 TACTGTGATGTACCTAGATGTGG - Intronic
1129658426 15:77539898-77539920 TACAGTGAATTGACTGTAGGGGG + Intergenic
1129930683 15:79408194-79408216 TAGAGTGATGTGAGCAGAGAGGG - Intronic
1130677317 15:85964723-85964745 GACAGCCATGTGCCTAGAGGAGG - Intergenic
1131623866 15:94097257-94097279 TAAAGTGAAGTCACTGGAGGCGG + Intergenic
1133452155 16:5912761-5912783 TACAGTGAAATAATTAGAGGCGG + Intergenic
1141860983 16:86716095-86716117 GACATTGATGTGACTAGCAGTGG - Intergenic
1144823219 17:18089846-18089868 TGCAGTGATGGGACAGGAGGGGG + Intronic
1145082492 17:19906619-19906641 CGCAGTGCTGTGACTACAGGAGG - Intronic
1146794885 17:35773913-35773935 CAGAGTGAAGTGTCTAGAGGTGG - Intronic
1149287616 17:55182646-55182668 TACTATGATGTGTCTAGATGTGG - Intergenic
1155680954 18:28484903-28484925 TACTGTGATGTGTCTAGTTGTGG - Intergenic
1156055006 18:32991777-32991799 TGCAGGGATGTGCCTGGAGGTGG - Intronic
1156321045 18:36022699-36022721 CAAAGTGCTGTGACTACAGGTGG - Intronic
1159093678 18:63877299-63877321 CACAGTGATGTGCCTTGGGGTGG - Intronic
1160679218 19:405095-405117 TACGGGGCTGTGTCTAGAGGGGG + Intergenic
1161756122 19:6135619-6135641 GCCAGTGATGTCACAAGAGGTGG + Intronic
1167342516 19:48924142-48924164 TAAAGTGCTGGGACTACAGGTGG - Intergenic
1167532075 19:50024197-50024219 TAAAGTGCTGGGACTACAGGCGG + Intronic
1168097045 19:54121855-54121877 CACAGTGATGGGACCAGTGGAGG + Exonic
1168373160 19:55853232-55853254 TACTGTGATGTGCCTGGATGTGG + Intronic
925137705 2:1532129-1532151 CACAGTGAGGGGATTAGAGGAGG - Intronic
926940498 2:18131308-18131330 TACAGAGATGTGACTTCAGGGGG - Intronic
926963076 2:18380099-18380121 TCCACTGATGTGACAGGAGGCGG - Intergenic
932449436 2:71800187-71800209 TACTCTGATGTAACAAGAGGAGG + Intergenic
933468561 2:82689360-82689382 TACTGTAATGTGACTAGGTGTGG + Intergenic
935631885 2:105218772-105218794 TAAAGTCATGTGGCTAGGGGAGG + Intergenic
935664297 2:105496771-105496793 TACAGGGATGTGAGGAGAAGGGG + Intergenic
937578383 2:123453538-123453560 TAAAGTGATGTAATTAGATGAGG - Intergenic
938200758 2:129371140-129371162 TACAATGATGTGCTTAGAGCAGG + Intergenic
939586234 2:144009289-144009311 TTCAGTGAGGTGAACAGAGGTGG + Intronic
940665139 2:156599906-156599928 TAAACTGATGTGACTTGTGGTGG - Intronic
942100667 2:172579743-172579765 TTCAGTGATGTGACTTGGTGTGG + Intronic
946815420 2:223572584-223572606 TCCAGTCATGTGTCTAGAAGTGG - Intergenic
946951954 2:224885989-224886011 TTCTGTGCTGTGACCAGAGGAGG + Intronic
947664781 2:231897616-231897638 TACCGTGGTCTAACTAGAGGAGG + Intergenic
947964161 2:234265155-234265177 TACAATGATGAGACTTGGGGAGG + Intergenic
1169908071 20:10623697-10623719 CACAGTGATGTGCCAAGAAGGGG - Exonic
1171358559 20:24569179-24569201 TACTGTGATTTGACCACAGGAGG + Intronic
1174480541 20:50828260-50828282 GGCAGTGCTGTGACCAGAGGAGG + Intronic
1175000279 20:55620446-55620468 TACAGTGATGTGAGGATAAGGGG - Intergenic
1176856910 21:13981165-13981187 TACAGGGAGGTGATTGGAGGGGG - Intergenic
1176867680 21:14063056-14063078 TACAGGGAGGTGATTGGAGGGGG + Intergenic
1178038926 21:28617513-28617535 CATAGTATTGTGACTAGAGGTGG - Intergenic
1181868569 22:25879476-25879498 TACGGTCATGTGACTGGAGAAGG + Intronic
1182203295 22:28596092-28596114 TAGAATGATGTGACTAAAGATGG + Intronic
1183220490 22:36509194-36509216 TAAAGTGGTGTGACTAGTGCCGG - Intergenic
953728841 3:45427735-45427757 GACAGAGTTGTGACTGGAGGAGG - Intronic
954852948 3:53618628-53618650 TGCAGTGCTATGCCTAGAGGAGG - Intronic
957156047 3:76545946-76545968 TACAATGATTATACTAGAGGAGG + Intronic
958731620 3:97966178-97966200 TCCAGTGATTTAACTTGAGGTGG - Intronic
959961930 3:112307120-112307142 TCCAGTTGTGTGACTAGAGCAGG - Intergenic
960275750 3:115727324-115727346 TACAGTTATGAAACTAGACGTGG + Intergenic
961373227 3:126445373-126445395 TGCAGAGATGTGTCTAGGGGTGG - Intronic
961535757 3:127569595-127569617 TACTGAGATGTGAGTAGAGGTGG - Intergenic
961802420 3:129461989-129462011 TACAATGAAGTCACTAGATGAGG + Intronic
966286515 3:178302411-178302433 TGCAGTGATGTGAGTAGCTGGGG + Intergenic
966805073 3:183800747-183800769 TACAGTGATGTGACTAGAGGTGG + Intronic
967474691 3:189902829-189902851 TTCAGTGAGGAGACTAGAGGTGG + Intergenic
970251215 4:14117962-14117984 TACAGTGATGTGGATAGAAAGGG - Intergenic
970295298 4:14623389-14623411 TACTGTGATGTCACTGAAGGTGG + Intergenic
970691105 4:18621698-18621720 TTCAGTGCTGTGGCTAGAGTAGG - Intergenic
970989807 4:22199695-22199717 TACAGTGTTGTGACTACAAATGG + Intergenic
971127218 4:23767212-23767234 TACAGTTATGTGGCCAGAGGCGG - Intronic
971159587 4:24120314-24120336 GACAGGGATGTGGCTAGAGATGG + Intergenic
971579089 4:28310430-28310452 TACAGTGTTGTGCCTGGAGTTGG - Intergenic
974216843 4:58858296-58858318 TCCAGTGACGTGAAGAGAGGAGG + Intergenic
976185953 4:82443065-82443087 CACAGTGCTGGGACTACAGGCGG + Intronic
978284120 4:107054655-107054677 TAAAGAGTTGTGACTAGAGTTGG - Intronic
978666682 4:111192732-111192754 TACAGTAGGGTGACTAGAGTTGG - Intergenic
978865238 4:113499812-113499834 AACAGTGATGTGGCCAAAGGAGG + Intronic
982875911 4:160649365-160649387 TACTGTGATGTGTCTAGGCGTGG - Intergenic
983880372 4:172925532-172925554 TAAACTCATGTGACTAGATGAGG - Intronic
984755166 4:183319469-183319491 CACAGTGAGATGACTAGAGCGGG + Exonic
985564419 5:608306-608328 TACAGTGAGGGGACTTGAGAGGG - Intergenic
985963973 5:3325485-3325507 GACAGTGCTGTGACCAGCGGGGG + Intergenic
988478829 5:31612288-31612310 TACAGTGAGGTGAATACAGCAGG - Intergenic
989237429 5:39165043-39165065 TACAGACATGTGACAAGAGAAGG + Intronic
989321147 5:40135105-40135127 TAAAATGATGTGACCTGAGGTGG - Intergenic
990434521 5:55774769-55774791 TATATTGATGTGTCTAGATGTGG + Intronic
990654749 5:57942625-57942647 TACAGGGATGTGTTTAGAGAAGG + Intergenic
991966077 5:72092502-72092524 CACAGTGATGTGAGTGTAGGTGG - Intergenic
992215116 5:74518284-74518306 TCCAGAGATGTGAAGAGAGGTGG - Intergenic
993129845 5:83881955-83881977 TACATTGCTTTGACTAGAAGTGG + Intergenic
993916377 5:93747589-93747611 TATAGTGAGGTGACTGGAAGAGG - Intronic
996406978 5:123115052-123115074 TGCAGAGCTTTGACTAGAGGAGG + Intronic
998968954 5:147570548-147570570 TAAAGTGCTGGGACTACAGGCGG - Intergenic
999811204 5:155128961-155128983 CATAGTGATGTCACTAGAGAAGG - Intergenic
1005221021 6:23588734-23588756 GGCAATGATGTGAGTAGAGGAGG + Intergenic
1006055082 6:31378162-31378184 TACAGTGAGATGACTGGAGGTGG - Intergenic
1006729241 6:36223485-36223507 TACAGTGATGGAACTATGGGAGG - Intronic
1009494746 6:64332738-64332760 TCCAGTTGTGTGACTAGAGCAGG - Intronic
1009649666 6:66458665-66458687 TACTCTGATGTGAGTAGAGAGGG - Intergenic
1010862137 6:80926090-80926112 TACAGTGTTATGGCTAGAGTTGG + Intergenic
1013304467 6:108835486-108835508 GACAGTGATGAGAGGAGAGGTGG - Intergenic
1014884486 6:126763312-126763334 TAAAGGTATGTGAGTAGAGGAGG - Intergenic
1014971784 6:127825325-127825347 CACAGTAATGTGACTTGGGGTGG - Intronic
1020069587 7:5217556-5217578 TAAAGTGCTGGGACTACAGGCGG + Intronic
1020840857 7:13215884-13215906 TCCAGTGATCTGACAGGAGGTGG - Intergenic
1020968796 7:14906760-14906782 TACAGTGCTGTGATTAAAGATGG - Intronic
1021082962 7:16385338-16385360 TACTATGATGTGTCTAGATGTGG - Intronic
1022573170 7:31472955-31472977 TCCACTGATCTGACAAGAGGCGG + Intergenic
1024119913 7:46226151-46226173 TACAGAGATGGGACTGGAGAGGG + Intergenic
1024529528 7:50379855-50379877 CCCAGTGAAGTTACTAGAGGGGG + Intronic
1026650851 7:72214785-72214807 TGCAGTGATTTGACAGGAGGTGG - Intronic
1027045891 7:74991297-74991319 TACAGTGAGATGACTAGCGTGGG - Intronic
1029350280 7:100008595-100008617 TGCAGTCATGTGACTGGACGTGG + Intergenic
1030080102 7:105770121-105770143 TGCAGTGATGTGATTAGTTGGGG + Intronic
1030779383 7:113580318-113580340 TACAGTCTTGTGAGTAAAGGTGG + Intergenic
1033254965 7:139792560-139792582 CACAGTGATGGGAATACAGGTGG + Intronic
1036505606 8:9352471-9352493 GACTGTGATGTGCCTAGATGTGG + Intergenic
1038853673 8:31307096-31307118 TAGAGAGATGTGAAGAGAGGAGG + Intergenic
1042217128 8:66438157-66438179 TACAGTGTGGGGAATAGAGGTGG + Intronic
1047480473 8:125277304-125277326 TTCAGAGAGGTGACTTGAGGAGG - Intronic
1047692533 8:127371104-127371126 TGCAGTCATTTGACTAGAGTAGG - Intergenic
1047986646 8:130242091-130242113 TACATTAATGTGCCTAGAAGTGG + Intronic
1051596135 9:18825999-18826021 TACAGTGATGAGACAGGAAGAGG - Intronic
1052303567 9:26980350-26980372 TACGAAGATGGGACTAGAGGTGG - Intronic
1053019280 9:34683819-34683841 TCCAGAGATATGATTAGAGGAGG + Intergenic
1053446324 9:38155893-38155915 TAAGGTGATGTTACTAGAAGGGG - Intergenic
1059001261 9:110350921-110350943 TGCAATGTTGTGACCAGAGGAGG - Intergenic
1059062934 9:111052588-111052610 TACAGTGCTGGGATTACAGGCGG + Intergenic
1059314922 9:113416055-113416077 AACAGGGAAATGACTAGAGGAGG - Intronic
1060284563 9:122237536-122237558 TACAGTGATGCCACTAGGGCTGG + Intergenic
1188904274 X:35773577-35773599 ACCACTGATGTGACAAGAGGTGG - Intergenic
1190379038 X:49820141-49820163 ACCAGTGATGTGACAGGAGGTGG - Intergenic
1193959752 X:87910783-87910805 TGCAGGGATGTGGATAGAGGTGG + Intergenic
1200779566 Y:7202023-7202045 TCCAGTGGTGTGGCTAGAGCAGG - Intergenic
1201143449 Y:11047442-11047464 AACAGTGATGAGTCTAGTGGTGG + Intergenic
1201613828 Y:15873422-15873444 TACAGTGATCTGATTAGTTGAGG - Intergenic