ID: 966807080

View in Genome Browser
Species Human (GRCh38)
Location 3:183816138-183816160
Sequence TGCCAGGGCTAGCACCTGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966807067_966807080 26 Left 966807067 3:183816089-183816111 CCTCTCATCAAGAGCATTTCCTT 0: 1
1: 0
2: 1
3: 14
4: 191
Right 966807080 3:183816138-183816160 TGCCAGGGCTAGCACCTGGGAGG 0: 1
1: 0
2: 1
3: 26
4: 223
966807073_966807080 7 Left 966807073 3:183816108-183816130 CCTTTGCTGGCATGAGGGGAGGG 0: 1
1: 0
2: 4
3: 20
4: 272
Right 966807080 3:183816138-183816160 TGCCAGGGCTAGCACCTGGGAGG 0: 1
1: 0
2: 1
3: 26
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966807080 Original CRISPR TGCCAGGGCTAGCACCTGGG AGG Exonic
900103797 1:973800-973822 AGCCAGGGCTGGGGCCTGGGTGG - Intronic
900239316 1:1607149-1607171 TGCCAGAGTTAGCACGTGGCAGG - Intergenic
901233253 1:7652800-7652822 TGCCAGGACCAGCTCCTAGGAGG - Intronic
901629947 1:10643128-10643150 TGGCTGGGCTCTCACCTGGGGGG + Intronic
901889532 1:12250739-12250761 AGCCAGGTCTTGAACCTGGGTGG + Intronic
902058062 1:13618696-13618718 TGCCCTGGCCAGCTCCTGGGTGG + Intergenic
902391755 1:16111087-16111109 GGCCAGGGTTGGCCCCTGGGTGG - Intergenic
905827500 1:41037200-41037222 TGCCTGGCCTTGCACCTGGGAGG - Intronic
905924666 1:41741025-41741047 GGCCAGGGCTGGCACATGGTAGG - Intronic
906701297 1:47860046-47860068 TGCACTGTCTAGCACCTGGGAGG - Intronic
914512777 1:148348754-148348776 TGCTGGAGCCAGCACCTGGGAGG + Intergenic
915353319 1:155240063-155240085 TGCAGGGGCGGGCACCTGGGAGG + Exonic
917096734 1:171405564-171405586 TGCTTTGGCTGGCACCTGGGTGG + Intergenic
919795207 1:201317566-201317588 TGGCAGGTCTATCAGCTGGGAGG + Exonic
920206025 1:204292690-204292712 TGCCAGTGGCAGCACCTGAGAGG + Intronic
923092809 1:230752750-230752772 TGCCAGGGCTATCCCCTGGCAGG + Intronic
923802874 1:237227547-237227569 GGCCAGGGCTAGTGTCTGGGTGG + Intronic
1067046654 10:42988969-42988991 GTCCAGGGCTAGCATCTAGGGGG + Intergenic
1067807032 10:49399534-49399556 TGCAGTGGCTAGAACCTGGGGGG - Intergenic
1068701499 10:60024707-60024729 TGCCTGGGAGAGCACCTGGAAGG + Intergenic
1070542296 10:77425008-77425030 GGCCAGGGCAGGCACCTGGGAGG + Intronic
1070665061 10:78336887-78336909 TGTCAAGGCTAGCACATGAGGGG - Intergenic
1077453163 11:2662973-2662995 GGCCAGGCCTTGCACCTGGCTGG - Intronic
1077548591 11:3188844-3188866 TGTCAGGTCCAGCAGCTGGGAGG - Intergenic
1080746997 11:35116967-35116989 TGCCAGGGCCAGTGCCTGGGAGG + Intergenic
1080993351 11:37569234-37569256 CTCCAGGACTTGCACCTGGGAGG - Intergenic
1081757622 11:45555905-45555927 TGCCAGGGACAGCAGCTGTGGGG + Intergenic
1081860838 11:46332726-46332748 TGCCTGGACTAGGACCCGGGCGG + Intergenic
1083164074 11:60872913-60872935 TGCCAGGCCCTGCACCTGGTGGG - Intronic
1084019531 11:66409403-66409425 TGCCAGGCCTAGCGCCTTCGGGG + Intergenic
1084021916 11:66422840-66422862 GGCCAGGGCCAGGACCTGGGCGG - Exonic
1084605478 11:70169465-70169487 TGCCAGGGCTGGGGCCTGGGAGG - Intronic
1085228302 11:74942572-74942594 TGCCAGGGCTGGGACTAGGGTGG - Intronic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1088358517 11:108967808-108967830 TGCCAGGCTGAGCTCCTGGGAGG + Intergenic
1088604388 11:111514378-111514400 TGCCAGGGACAGCACCTGCTAGG - Intergenic
1089617481 11:119703103-119703125 TCCCAGGGCCTGCACATGGGAGG + Intronic
1091303377 11:134521914-134521936 TGCCGAGGTTAGCACCAGGGAGG + Intergenic
1092033908 12:5313798-5313820 AGGCAGGGCTTGAACCTGGGAGG + Intergenic
1095304091 12:40620558-40620580 TGCCTGGGCTCGCACGTTGGCGG + Intergenic
1096244526 12:49976695-49976717 AGCTGGGGCAAGCACCTGGGAGG - Exonic
1098007358 12:66011868-66011890 TGACAGGGCTAGAACATGTGGGG + Intergenic
1099957563 12:89365983-89366005 TGCCAGGGAGAGGAACTGGGTGG - Intergenic
1100764528 12:97849044-97849066 TGCCCAGTCTAGCCCCTGGGTGG - Intergenic
1101652394 12:106689439-106689461 TGCCAGGCCTGGCACCTAGCAGG - Intronic
1102240621 12:111322413-111322435 TGACAGGCCCAGCACCTGCGAGG - Exonic
1105771604 13:23617354-23617376 GGCCAGGGGGAGCACCAGGGAGG + Intronic
1105948873 13:25212106-25212128 TGCCAGGGCTGGTCCCTCGGTGG - Intergenic
1107297113 13:38921379-38921401 TGCCTGGGCTTGAACCAGGGAGG + Intergenic
1107789047 13:43982319-43982341 GGCCTGTGCTAGCACCTGGCTGG - Intergenic
1112544856 13:100357430-100357452 TTCCTGGGCTACCACCTGGAAGG + Intronic
1114632088 14:24165563-24165585 AGCCAGGGCTGCTACCTGGGAGG + Intronic
1115462121 14:33673226-33673248 TGCCAGTGCTACTACCTGAGAGG + Intronic
1115770285 14:36659641-36659663 TGCCAGGGGTAGCAACTCAGTGG - Intronic
1117061216 14:51965870-51965892 TACCAGGGCTGGGACCAGGGTGG + Intronic
1118148375 14:63164616-63164638 GGCCAGGGCCGGCACCTGGTAGG - Intergenic
1118776392 14:68976921-68976943 TCCCAGGGCTCTGACCTGGGTGG - Intronic
1118838856 14:69496223-69496245 TGCCAGGGCTGGGAAGTGGGTGG - Intronic
1120840631 14:89082133-89082155 TACCAGGCTTAGTACCTGGGTGG - Intergenic
1122142237 14:99669202-99669224 TGCCATTCCCAGCACCTGGGCGG - Intronic
1122409113 14:101517087-101517109 TGCTGGAGCCAGCACCTGGGAGG - Intergenic
1122825611 14:104369045-104369067 GCCCAGGGCTGGCACCTGGAGGG + Intergenic
1122863540 14:104593396-104593418 TGCCTGGGGAAGCAGCTGGGGGG - Exonic
1122902015 14:104785938-104785960 TGTCAGGGGCAGCACCAGGGAGG - Intronic
1123946219 15:25240177-25240199 TGCCAGGGGGCCCACCTGGGTGG - Intergenic
1126329962 15:47521479-47521501 TGCCAGAGCTGGCACATGGCAGG + Intronic
1127935974 15:63638520-63638542 TTCTAGGACTGGCACCTGGGAGG - Exonic
1128729735 15:70013131-70013153 TGACAGGGCTAGGAACAGGGTGG - Intergenic
1128784380 15:70384037-70384059 TGGCAGGGCCAGCTTCTGGGAGG - Intergenic
1129056519 15:72824206-72824228 AGCCAGGGCTATGAGCTGGGTGG - Intergenic
1129409505 15:75341323-75341345 TGCCAGGGTTGGCACATGGAGGG + Intronic
1129684684 15:77678337-77678359 TGCCAGGGGTAGGGGCTGGGAGG - Intronic
1131055538 15:89372254-89372276 TACCAGAGCTAGGTCCTGGGGGG - Intergenic
1131222550 15:90597143-90597165 TGCCAGGGCTTGCTCCTGGCTGG + Intronic
1133176064 16:4015479-4015501 TGACAGCGATAGCACCTGGTGGG - Intronic
1133709033 16:8383156-8383178 AATCAGGGCAAGCACCTGGGAGG + Intergenic
1134440023 16:14293926-14293948 TGCCAGGTCTAGCACATGGTGGG - Intergenic
1135274023 16:21095525-21095547 TGCCAGGGGTTACAACTGGGGGG + Intronic
1136552036 16:30986927-30986949 CGCCAGGGCCTGCGCCTGGGAGG + Exonic
1136718341 16:32302049-32302071 GGCCAGGACAAGCACCTGGCAGG + Intergenic
1136836715 16:33508319-33508341 GGCCAGGACAAGCACCTGGCAGG + Intergenic
1138560374 16:57797634-57797656 TGCCTGGGCTGGCCCCTGGACGG - Intronic
1138575921 16:57907262-57907284 TGCCAGGCTTAGCCCCAGGGAGG + Intronic
1139106584 16:63834467-63834489 TGCTAGGCTTAGCACATGGGTGG + Intergenic
1139951892 16:70676472-70676494 TGCCAGGCCTAGCACCGTGTGGG - Intronic
1141256385 16:82406104-82406126 TGCTTGGGCCAGCACCTAGGGGG - Intergenic
1141697146 16:85625503-85625525 TCCCAGGGGTGTCACCTGGGGGG - Intronic
1142118020 16:88370456-88370478 TCCCAGGGCTAGTGACTGGGGGG - Intergenic
1142226107 16:88878355-88878377 TGCCTGGGCCAGCCCCGGGGTGG - Intronic
1142252197 16:88997095-88997117 TCCCAGAGCCAGCACCTGTGGGG + Intergenic
1203008087 16_KI270728v1_random:215716-215738 GGCCAGGACAAGCACCTGGCAGG - Intergenic
1144467079 17:15505574-15505596 TGCCAGGGCTCCCACTTTGGCGG + Intronic
1144729169 17:17516875-17516897 TGCCTGGGGTAGCCACTGGGCGG - Intronic
1144799222 17:17913434-17913456 GGCCAGGGCCGGCACCTGGTAGG + Intronic
1146790915 17:35750099-35750121 TGGCAGGGCTGGCGCCTGGGGGG + Exonic
1147446086 17:40476079-40476101 TGGCAGGGCTGGCTGCTGGGAGG + Exonic
1152070111 17:78130181-78130203 ACCCAGGCCTAGCACCTGGCCGG - Intronic
1152457191 17:80423264-80423286 TGCCAGGGTCAGCACCTCGCTGG - Intronic
1152727971 17:81956981-81957003 AGCCAGGCCTCGCACCTGGATGG + Exonic
1152800960 17:82330446-82330468 TGGCAGAGCCAGCACCTGGGTGG - Intronic
1152993924 18:388738-388760 TGCCAGCTCTGGGACCTGGGTGG - Intronic
1153642605 18:7169699-7169721 TGTCAGGGACAGCACCTGGGGGG - Intergenic
1154192608 18:12243280-12243302 GGCCAAGGCTGGCAGCTGGGAGG - Intergenic
1154323072 18:13369930-13369952 AGCCACGGCTCGCTCCTGGGTGG - Intronic
1156968539 18:43126963-43126985 AGCCAGGGTTAGCTCCTGGAAGG - Intergenic
1160385782 18:78495403-78495425 TACCATGGCTGGCTCCTGGGTGG - Intergenic
1161142053 19:2653852-2653874 GGCCAGGGACAGCGCCTGGGTGG - Intronic
1161490077 19:4556792-4556814 GGCCAGGGCTGGCAGTTGGGCGG + Intronic
1162163772 19:8739137-8739159 GGCCAAGGCTGGCAGCTGGGAGG - Intergenic
1162799136 19:13101402-13101424 TGCGCTGCCTAGCACCTGGGGGG - Intronic
1164686811 19:30172205-30172227 AGCCATGGCTAGAAGCTGGGAGG + Intergenic
1164766694 19:30777800-30777822 TGACATGGCCAGAACCTGGGAGG + Intergenic
1165404128 19:35619605-35619627 GACCAGAGCTAGCACCTGTGGGG - Exonic
1166108824 19:40610651-40610673 TGCCAGGGTGAGGGCCTGGGAGG + Exonic
1166129541 19:40737762-40737784 AGCCAGGGCTCGCACCTCGTGGG - Exonic
1167613282 19:50517511-50517533 CGCCCGGGCTGGGACCTGGGTGG + Exonic
925147722 2:1592104-1592126 CGCCTGGGCTCGCATCTGGGTGG + Intergenic
925849014 2:8062325-8062347 TGCCAGGCCCAGCACGTGGCAGG - Intergenic
926253410 2:11169295-11169317 TGACAGTGCTGGCACCTGGCCGG - Intronic
927792071 2:26018134-26018156 TGACAAGGGTAGCACATGGGTGG + Intergenic
929249369 2:39735849-39735871 TGCCATAGCTTGCACATGGGTGG + Intergenic
932003402 2:67905432-67905454 TGACAGGCCAAGCAGCTGGGTGG - Intergenic
932490028 2:72114538-72114560 AGCCAGATCGAGCACCTGGGGGG + Intergenic
932654815 2:73601338-73601360 TGTCAGGGGCAGCACCTGGACGG + Exonic
935276103 2:101476529-101476551 TTCCAGGGCTGGCACGTGGGAGG - Intergenic
935523739 2:104141483-104141505 TGCCAGGGCCAGAAACTGGTAGG + Intergenic
935701776 2:105819087-105819109 TTCCAGAGCTAGCTCCTGGTCGG + Intronic
939527420 2:143314386-143314408 TACCAGGGCAAGCACATGGCTGG + Intronic
940326884 2:152434809-152434831 TTCCAGGGCCAGGACTTGGGTGG + Intronic
943473829 2:188329870-188329892 TGCCAAGTTTAGCAACTGGGTGG + Intronic
944263366 2:197697609-197697631 GGCCAGGGCCGGCACCTGGTAGG + Intronic
945568700 2:211436395-211436417 TGACAGGGCTAGAACATGGCAGG - Intronic
945984279 2:216341465-216341487 TGCAAAGGGTAGCATCTGGGAGG + Intronic
947729275 2:232419185-232419207 TGCGGGGGCTGGGACCTGGGCGG - Intergenic
947741254 2:232486010-232486032 TGCGGGGGCTGGGACCTGGGCGG - Exonic
948243310 2:236456691-236456713 TGCCAGAGCTGGCACCTGATGGG + Intronic
948251887 2:236536086-236536108 TGCTAGGCCTAATACCTGGGAGG - Intergenic
1170369087 20:15628720-15628742 TCCCAGGTCTGGCACCTTGGTGG + Intronic
1170431731 20:16282618-16282640 TACCAAGCCTAGCAGCTGGGAGG + Intronic
1170599719 20:17831942-17831964 TGGCTGGGCTACCACCTGTGGGG - Intergenic
1171481909 20:25460754-25460776 CGCCAGGGCCAGCGCCGGGGGGG + Intronic
1171892422 20:30728482-30728504 TGACAGGGGCAGCTCCTGGGGGG + Intergenic
1172020661 20:31911532-31911554 GGCCAGGGGAAGAACCTGGGAGG - Intronic
1173862924 20:46296090-46296112 TTTCAGGACAAGCACCTGGGAGG - Intronic
1175105079 20:56609430-56609452 AGCCAGGCCTGGCATCTGGGAGG + Intergenic
1175864035 20:62165100-62165122 CGCCACCGCTAGCTCCTGGGAGG - Intronic
1179587500 21:42383087-42383109 TTCCAGGGCTACCACCTGTGCGG - Exonic
1180945379 22:19689530-19689552 TGGCAGGGCCAGCCCCTGTGAGG + Intergenic
1181311302 22:21946310-21946332 TGCCAGGAGCAGCAGCTGGGTGG + Intronic
1181689360 22:24549849-24549871 TTCCAGGGCTGGCACATGGGAGG + Intronic
1182071219 22:27465075-27465097 GGACAGGGCTGGCTCCTGGGAGG + Intergenic
1182282565 22:29225814-29225836 TGGCTGGGCCAGCAGCTGGGAGG + Intronic
1182584964 22:31339709-31339731 TGCCTGGGCCAGGACCTGGCAGG - Intronic
1183185246 22:36288165-36288187 TGCCAGGGCTCGGCCCAGGGCGG - Intronic
1184164275 22:42718696-42718718 TGCCAGGCCTGGCACCTAGCAGG - Intronic
1184343884 22:43901156-43901178 TGCCAGGGCAGACACCTGAGAGG + Intergenic
1184642603 22:45880367-45880389 TGCCAGGAGCAGCCCCTGGGTGG - Intergenic
1184657306 22:45948295-45948317 TGCCACAGCTGGCACCTGGAGGG + Intronic
950709668 3:14805276-14805298 TGCCTGAGCAAGCACCTGGAGGG - Intergenic
953854875 3:46493661-46493683 GGCCAGGGCTGGCACCTGGTAGG - Intergenic
954599550 3:51857727-51857749 GGCCAGGGCCGGCACCTGGTAGG - Intergenic
959743894 3:109753825-109753847 TGCTAGGTGTAACACCTGGGTGG + Intergenic
966807080 3:183816138-183816160 TGCCAGGGCTAGCACCTGGGAGG + Exonic
966934445 3:184696692-184696714 TGTCAAGGCCCGCACCTGGGAGG - Intergenic
967284238 3:187853234-187853256 TGCCTGGGCTTGCTCCTGGAGGG - Intergenic
967727416 3:192874649-192874671 TTCCAGGGCAAGGAGCTGGGAGG - Intronic
968655791 4:1777944-1777966 TGCCTGGGCTAGGACCTGCCTGG - Intergenic
968762427 4:2449584-2449606 TGCCAGGGCTGACAGCTTGGTGG - Intronic
969456976 4:7305845-7305867 TGCCAGAGGCAGCATCTGGGGGG - Intronic
970649396 4:18159752-18159774 TGCCTGGGCTCGCACTTTGGTGG - Intergenic
970999008 4:22301480-22301502 TGTCATGGCTAGCATTTGGGAGG - Intergenic
971639748 4:29117230-29117252 TGCCTGGGCTACCACTTTGGCGG + Intergenic
975409866 4:74037864-74037886 TTCCAGGCCTAACCCCTGGGAGG - Intronic
977572744 4:98646459-98646481 TGTTAGGCCTAACACCTGGGTGG - Intronic
979273635 4:118791883-118791905 GGCCAGGGCAGGCGCCTGGGAGG - Intronic
980496692 4:133594046-133594068 TTCCAGCCCTAGAACCTGGGAGG + Intergenic
980512400 4:133811994-133812016 TGCCATGTGTAGCTCCTGGGTGG - Intergenic
981655618 4:147109425-147109447 TGCCAGGCCTTGCAGCTAGGTGG - Intergenic
986224576 5:5801029-5801051 TGACAGGGCCAGGACATGGGAGG - Intergenic
988850130 5:35172553-35172575 TGTCAGGGCTAGCAACTGTACGG - Intronic
995846484 5:116499388-116499410 TGCCATGGCTTGAACCTGGGCGG + Intronic
997531950 5:134586966-134586988 TGCCAGGGCTAGGGCCTAGCGGG - Intergenic
997581988 5:135023957-135023979 TGCCAGGGCCAGCCTCTGGGAGG + Intergenic
998230884 5:140360862-140360884 TGCCAGGGTGGGCACGTGGGGGG - Exonic
998617181 5:143753098-143753120 TTCCAGTGCTAGCACGTAGGAGG - Intergenic
999475594 5:151895746-151895768 GGCCATGGGAAGCACCTGGGAGG - Intronic
1006393981 6:33775103-33775125 TGCCAGGGCCAGGAATTGGGTGG + Intronic
1006515021 6:34541022-34541044 CGCCAGCGCTCGCCCCTGGGTGG - Exonic
1006826380 6:36939073-36939095 GGCCAGGGCCGGCACCTGGTAGG + Intergenic
1007080737 6:39101655-39101677 TGCCAGAGATCACACCTGGGAGG + Intergenic
1007746585 6:44046939-44046961 TCACAGGGCTTGCATCTGGGAGG + Intergenic
1007781117 6:44255354-44255376 GGCCTTGGCCAGCACCTGGGTGG + Exonic
1009796641 6:68477786-68477808 TGCCAGGGATAGAACCTGGATGG - Intergenic
1010246204 6:73661896-73661918 GGCCAGGGCCGGCACCTGGTAGG + Intergenic
1015772038 6:136778906-136778928 TGCCAGTGCCAGCACTTTGGGGG + Intronic
1018059374 6:160078702-160078724 GGACAGGGCCAGCTCCTGGGTGG + Intronic
1018861310 6:167712606-167712628 TGCCAGGGCTAGGATGTGGATGG + Intergenic
1020046673 7:5045965-5045987 CGCCCGGGCCAGCACCTAGGCGG + Exonic
1020063756 7:5171786-5171808 TGCCAGTAGTAGCATCTGGGAGG - Intergenic
1022091251 7:27109386-27109408 TTCCAGAGCTAGGATCTGGGGGG - Intronic
1022718160 7:32917147-32917169 GTCCAGAGCTAGCACCTGGAAGG + Intergenic
1022738126 7:33095037-33095059 GTCCAGAGCTAGCACCTGGAAGG + Exonic
1023306230 7:38830942-38830964 AGCCAGGGCTACAACCTGGGAGG + Intronic
1023638885 7:42238218-42238240 TGCCAGGGCGCGCATTTGGGGGG - Intergenic
1024045432 7:45582550-45582572 GGCCAGGGCAGGCACCTGGCGGG + Intronic
1026727230 7:72879462-72879484 CGCCCGGGCCAGCACCTAGGCGG + Exonic
1026949569 7:74338390-74338412 TGTTAGGGCTGGCCCCTGGGTGG - Intronic
1027121923 7:75527994-75528016 CGCCCGGGCCAGCACCTAGGCGG - Intergenic
1027275202 7:76549438-76549460 CGCCCGGGCCAGCACCTAGGCGG + Intergenic
1029720910 7:102363988-102364010 TGCCCGGGCCAGCACCTAGGCGG + Exonic
1030131641 7:106206817-106206839 TACTAGGGTTAGCACCTGTGGGG + Intergenic
1031239525 7:119219804-119219826 GGCCTGGTCTAGCACCCGGGTGG - Intergenic
1032191360 7:129767685-129767707 TGGCAGAGCTAGAACCAGGGTGG - Intergenic
1033007632 7:137584757-137584779 TGCCAGTGTTACCACTTGGGTGG - Intronic
1034286550 7:149887483-149887505 AGCCAGTGCTGGCACCTGGAAGG - Intergenic
1035012732 7:155733962-155733984 TGCCAAGTCTGGAACCTGGGAGG - Intronic
1035031131 7:155861388-155861410 CCCCAGGGCCAGCACCAGGGTGG + Intergenic
1036935350 8:12996860-12996882 TGCCTGGGGTAGCAGCTGGCAGG - Intronic
1037898814 8:22675722-22675744 TGCCAAGGCCAGCACCTTTGGGG + Intergenic
1038354665 8:26816425-26816447 TTCCAGGGGCAGCACATGGGTGG - Intronic
1042806393 8:72775226-72775248 GGGCTGGGCTAGCCCCTGGGTGG - Intronic
1047450349 8:124959951-124959973 TGCCGTGGCTTGCACCTGGGAGG + Intergenic
1047521265 8:125597029-125597051 GGCCAGAGCTAGCAACTCGGGGG - Intergenic
1047633540 8:126734444-126734466 AGGCAGGGCTTGAACCTGGGAGG - Intergenic
1047644444 8:126855098-126855120 AGCCTGGGGTGGCACCTGGGTGG - Intergenic
1048716111 8:137272085-137272107 TGCTAGGCCTAGCACCTGGGTGG + Intergenic
1049483828 8:142840937-142840959 GGCCCAGGCTAGCTCCTGGGAGG - Intronic
1049508787 8:143017758-143017780 TGACAGGGCGAGCACCAGGGAGG - Intergenic
1049612735 8:143562954-143562976 TCCTAGGGCTAGCAGCTGGTGGG - Exonic
1050151159 9:2621296-2621318 TGACGGGGCGTGCACCTGGGGGG - Intergenic
1051042463 9:12828423-12828445 GGCCATGGCTAGCAACTAGGGGG - Intergenic
1051305162 9:15700524-15700546 TGCCTGGGCTCGAACCTTGGCGG - Intronic
1053467015 9:38316210-38316232 TGCCAGGCTGAGCAGCTGGGCGG - Intergenic
1054356401 9:64067254-64067276 TGACAGGGACAGCTCCTGGGGGG - Intergenic
1059334753 9:113561936-113561958 TCCCAGGGCTAGGACCAGCGAGG - Intronic
1059356364 9:113702413-113702435 TGCCAGGGCTAGCTGCAGGTTGG - Intergenic
1059385092 9:113958387-113958409 AGCCAGGGCTGGCACACGGGAGG + Intronic
1059404742 9:114092701-114092723 TGTCATGGCTAGCACCAGGTAGG - Intronic
1186321939 X:8437167-8437189 TGGCATTGCTAGCACTTGGGAGG + Intergenic
1186645628 X:11504390-11504412 TGACACTGCTGGCACCTGGGGGG - Intronic
1188107332 X:26160532-26160554 TGGCAAGGCTGGCACCTGGACGG - Intergenic
1193497056 X:82227649-82227671 TGCCTGGGCTAGTACTTAGGTGG + Intergenic
1193911148 X:87308746-87308768 TGTCAGGGCTGGGACCTGGAGGG - Intergenic
1195896438 X:109749802-109749824 TGCCTGGGCTCCCACTTGGGCGG - Intergenic
1200253190 X:154564591-154564613 TGCCGCGGCCAGCTCCTGGGTGG - Exonic
1200264577 X:154639824-154639846 TGCCGCGGCCAGCTCCTGGGTGG + Intergenic
1200893744 Y:8352559-8352581 TGCTAGGCCTATCACCTAGGTGG - Intergenic
1202169261 Y:22023709-22023731 TGCCAGGGCTAGTTACTGGGTGG + Intergenic
1202222100 Y:22562656-22562678 TGCCAGGGCTAGTTACTGGGTGG - Intergenic
1202321015 Y:23633011-23633033 TGCCAGGGCTAGTTACTGGGTGG + Intergenic
1202549752 Y:26037045-26037067 TGCCAGGGCTAGTTACTGGGTGG - Intergenic