ID: 966807585

View in Genome Browser
Species Human (GRCh38)
Location 3:183819042-183819064
Sequence CTAGCTGGACACTTCCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966807585_966807595 23 Left 966807585 3:183819042-183819064 CCAAGGTGGAAGTGTCCAGCTAG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 966807595 3:183819088-183819110 GGAGTTGCTCCTGCCCAGGCTGG 0: 1
1: 0
2: 5
3: 113
4: 863
966807585_966807594 19 Left 966807585 3:183819042-183819064 CCAAGGTGGAAGTGTCCAGCTAG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 966807594 3:183819084-183819106 GTGCGGAGTTGCTCCTGCCCAGG 0: 1
1: 0
2: 1
3: 8
4: 152
966807585_966807590 2 Left 966807585 3:183819042-183819064 CCAAGGTGGAAGTGTCCAGCTAG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 966807590 3:183819067-183819089 GGGCCTGGCACCCACGTGTGCGG 0: 1
1: 0
2: 0
3: 16
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966807585 Original CRISPR CTAGCTGGACACTTCCACCT TGG (reversed) Intronic
900011515 1:114724-114746 CTGGATGGCCACTTCCACCATGG + Intergenic
900027618 1:291288-291310 CTGGATGGCCACTTCCACCATGG + Intergenic
900041576 1:470730-470752 CTGGATGGCCACTTCCACCATGG + Intergenic
900063010 1:705707-705729 CTGGATGGCCACTTCCACCATGG + Intergenic
900799528 1:4728712-4728734 CTTGCTGGAAACTTCTATCTTGG + Intronic
900962524 1:5934404-5934426 GCAGCTGTCCACTTCCACCTGGG + Intronic
902248765 1:15139749-15139771 ATTGTTGGACACTTGCACCTGGG - Intergenic
905172794 1:36118964-36118986 CTAGCATGAGACCTCCACCTGGG + Intronic
905387818 1:37616324-37616346 CCAGCCGCACACTTCCACCTTGG - Intronic
905793162 1:40800941-40800963 CTCCCTGTACATTTCCACCTTGG - Intronic
906668047 1:47635496-47635518 CCAGCTGGATGCTTCCACCTAGG + Intergenic
914446969 1:147758550-147758572 CTGGCTGAACTCTACCACCTGGG - Exonic
920178828 1:204120193-204120215 CTAACTGGAAACTTCCACATTGG - Intronic
922259955 1:223930732-223930754 CTGGATGGCCACTTCCACCATGG + Intergenic
923986199 1:239386043-239386065 CTCCCTGGACAGTTACACCTTGG - Intergenic
924009349 1:239647653-239647675 CCAGCTGGACAGCTCCACATGGG + Intronic
924341119 1:243033291-243033313 CTGGATGGCCACTTCCACCATGG + Intergenic
1066449903 10:35519533-35519555 GTAGCTGTCCACTTCCATCTGGG - Intronic
1066735351 10:38472116-38472138 CTGGATGGCCACTTCCACCATGG - Intergenic
1067538366 10:47133873-47133895 CAAGCTGCACCCTACCACCTTGG - Intergenic
1074967661 10:118506780-118506802 CTAGCTGAACACTGCCTGCTAGG + Intergenic
1075395571 10:122124550-122124572 CTAGCTGGACACTTGGGGCTGGG - Intronic
1075978575 10:126718143-126718165 CTTGATGGTCACCTCCACCTTGG + Intergenic
1076420020 10:130324690-130324712 CTTGCAGGACAGTTCCACCTTGG - Intergenic
1076967850 11:106958-106980 CTGGATGGCCACTTCCACCATGG + Intergenic
1083106540 11:60363701-60363723 CTAGCTTTACACTGCCACATAGG - Intronic
1084579441 11:70013947-70013969 CTAGATGGCCACCTCCTCCTTGG + Intergenic
1089639002 11:119834626-119834648 GTAGGTGCACACTTACACCTAGG + Intergenic
1092036348 12:5338503-5338525 CTGGCTGAACCCTTCTACCTTGG + Intergenic
1094818144 12:34205918-34205940 ACAGCTGGAGACTTCCTCCTGGG + Intergenic
1095864594 12:46957656-46957678 CTAGCTAGCCCCTTCCACCATGG + Intergenic
1102294996 12:111729614-111729636 AGAGCTGGTGACTTCCACCTTGG + Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1104923129 12:132301460-132301482 CCAGCTGGACACTTCCCCTCCGG + Intronic
1107582429 13:41805466-41805488 ATAGCTGGAGACTTCAACATTGG + Intronic
1108498246 13:51045615-51045637 CTAGCCTGACACTTCCAACAGGG + Intergenic
1108598972 13:51974257-51974279 CTATCGAGGCACTTCCACCTGGG - Exonic
1110655559 13:77994648-77994670 GTAGCTTGTCACTTCTACCTAGG - Intergenic
1119414882 14:74463232-74463254 CTAGCTAAACACTTCTTCCTTGG + Intergenic
1120344150 14:83263298-83263320 TTAGCTTGACACTGCCACCTGGG - Intergenic
1121818505 14:96946357-96946379 CTAGCTTGCCTCTTCCACCATGG - Intergenic
1122724002 14:103738795-103738817 CTTGCTGGGATCTTCCACCTAGG + Exonic
1122985126 14:105208400-105208422 CTGGCTGGGCACTTCCACTCGGG - Intergenic
1125540540 15:40467428-40467450 CTAGCTGAGCACTTCCACAAGGG + Exonic
1126229105 15:46305184-46305206 CTAGGTGGTTGCTTCCACCTGGG - Intergenic
1129250822 15:74308076-74308098 CTAGGTGGGCACGTCCCCCTTGG + Intronic
1129858576 15:78842411-78842433 CTTGCTGGGCACTTCCCTCTGGG + Intronic
1130679952 15:85988004-85988026 CTCCCTGGATACTTCCAACTAGG - Intergenic
1133058489 16:3159185-3159207 CTGACTGGAGCCTTCCACCTGGG + Intergenic
1136520697 16:30793957-30793979 CTAGCAGGCCCCTCCCACCTTGG + Intergenic
1139355580 16:66365411-66365433 CCAGCCTGACACCTCCACCTGGG + Intergenic
1139527224 16:67524529-67524551 CCTTCTGGACACTTCCTCCTTGG + Intronic
1142452830 16:90192181-90192203 CTGGATGGCCACTTCCACCATGG - Intergenic
1145824573 17:27867093-27867115 CTTGCTGGGCAGTTCCTCCTGGG - Intronic
1146891850 17:36511430-36511452 CTAGCTGGACTGCTGCACCTTGG - Exonic
1147314532 17:39613242-39613264 CTTCCTGGACACCTCCTCCTGGG + Intergenic
1148150771 17:45395534-45395556 CATGCTGGTCTCTTCCACCTCGG + Exonic
1152019464 17:77772853-77772875 CTGGCTGGGCCCTGCCACCTGGG + Intergenic
1156110443 18:33719737-33719759 CTAGCTAGTCCCTTCCACCATGG + Intronic
1160644655 19:176581-176603 CTGGATGGCCACTTCCACCATGG + Intergenic
1161801785 19:6420360-6420382 CTCACAGGACACTTCCTCCTGGG + Intronic
1162437618 19:10671605-10671627 CTAGCAGGACACTTCTTCCTGGG - Intronic
1163093936 19:15041892-15041914 CCAGCTGGACTCACCCACCTGGG + Intergenic
1164768658 19:30791219-30791241 CTAACTGGACACAGCCTCCTCGG - Intergenic
1164970854 19:32531417-32531439 ACATCTGCACACTTCCACCTTGG + Intergenic
1166812385 19:45522256-45522278 CTGGCTGGCCACTTCCTCCAGGG - Intronic
1168307876 19:55445351-55445373 CCCACTGGACACTTCCTCCTGGG + Intergenic
931302418 2:60993588-60993610 CCAGCTAAACATTTCCACCTGGG + Intronic
934945096 2:98535013-98535035 CTGACTGGACAGCTCCACCTGGG - Intronic
936132517 2:109858659-109858681 CTCACTGGACTCTGCCACCTGGG - Intergenic
936212180 2:110512826-110512848 CTCACTGGACTCTGCCACCTGGG + Intergenic
936421320 2:112367393-112367415 CTCACTGGACTCTGCCACCTGGG + Intergenic
937017144 2:118616626-118616648 CCAGCTGGGCACTACCTCCTTGG + Intergenic
937164057 2:119795318-119795340 CTGGCTGGCCTCTTCCACCCAGG + Intronic
937470857 2:122172683-122172705 GTAGCTGGATGCTTCCACCCTGG + Intergenic
938242534 2:129754503-129754525 CTAACTGGAAACGTCCAACTGGG - Intergenic
941168772 2:162112084-162112106 TCAGCTGGACAGTTCCAACTTGG - Intergenic
941182046 2:162271243-162271265 CTAGATGGATACTTTCAACTGGG - Intronic
941830394 2:169952012-169952034 CTGACTGGACACCTTCACCTGGG - Intronic
945862658 2:215141385-215141407 CTTGTTGCACATTTCCACCTAGG - Intergenic
945915403 2:215698610-215698632 TTAGCTGGGCAGTTCCAGCTTGG + Intergenic
946695466 2:222353641-222353663 CTAGCTTCACACTCTCACCTGGG + Intergenic
949084270 2:242136842-242136864 CTGGATGGCCACTTCCACCATGG - Intergenic
1170722952 20:18900367-18900389 CGAGCTGGAGACTTCCAAATTGG + Intergenic
1171935653 20:31272639-31272661 CTGGCTGGGCAGTTCCTCCTTGG - Intergenic
1176246433 20:64099437-64099459 CCACCTGGACACTTTCTCCTGGG - Exonic
1176280853 20:64309326-64309348 CTGGATGGCCACTTCCACCATGG - Intergenic
1179317856 21:40260904-40260926 CTGGCTGGGAACTCCCACCTGGG + Intronic
1179464227 21:41561124-41561146 CCAGCAGGACACTGCTACCTGGG - Intergenic
1180137414 21:45870763-45870785 CTAGCTGGACACACGCAGCTGGG - Intronic
1184131089 22:42516830-42516852 CGAGCTGGACACTTGCCACTGGG + Intronic
1184141261 22:42578689-42578711 CGAGCTGGACACTTGCGACTGGG + Intergenic
952735847 3:36690885-36690907 GTAGCTGGACACTTTAACATTGG - Intergenic
955379760 3:58428217-58428239 CCAGCTGGGCACTACCACCTTGG + Intronic
963213836 3:142723742-142723764 ATAGCTGGACAATTCCACAAAGG + Intergenic
965071858 3:163924841-163924863 CTGGCTGGACACTACCTCGTGGG - Intergenic
966807585 3:183819042-183819064 CTAGCTGGACACTTCCACCTTGG - Intronic
970434319 4:16018727-16018749 CTAGCTCCACTCTTCCACTTGGG + Intronic
978423074 4:108554596-108554618 CAAGCTGTACCCTGCCACCTTGG + Intergenic
979261705 4:118655080-118655102 CTGGATGGCCACTTCCACCATGG - Intergenic
980956687 4:139436051-139436073 ATAGCTAGAAACTTCCCCCTTGG + Intergenic
981046717 4:140271578-140271600 CTAGCTGGGAATTTCCAGCTTGG + Intronic
983150125 4:164268247-164268269 CTGGATGGCCACTTCCACCATGG + Intronic
991350977 5:65720729-65720751 TCAGATGGACACTTACACCTCGG - Exonic
994321590 5:98401110-98401132 CTAGCTGGAACTTTCCACCAAGG - Intergenic
999986049 5:157006505-157006527 CTAGCTTCACATTTCCACCTGGG - Intergenic
1000037388 5:157459870-157459892 CTATGTTGCCACTTCCACCTCGG + Intronic
1000228237 5:159290597-159290619 CAAGCTGGACACTTAATCCTGGG - Intergenic
1002082898 5:176748103-176748125 CAGGCTGGACACCTCCACCCTGG - Intergenic
1002732269 5:181348199-181348221 CTGGATGGCCACTTCCACCATGG - Intergenic
1002752269 6:125906-125928 CTGGATGGCCACTTCCACCATGG + Intergenic
1003643415 6:7894842-7894864 CTAGCTGGACAGTGCATCCTTGG - Intronic
1006740093 6:36301903-36301925 CTGGCAGTACACTTCCACCCGGG - Exonic
1007497332 6:42269146-42269168 CAAGCTGGACTCTTTCACCCAGG - Exonic
1010698455 6:79008766-79008788 CCAGCTGGCCATTTCCACATAGG + Intronic
1014615253 6:123590366-123590388 GTAACTGGACAGTCCCACCTGGG - Intronic
1018979529 6:168592069-168592091 CTGTCTTGACATTTCCACCTTGG + Intronic
1019236521 6:170620514-170620536 CTGGATGGCCACTTCCACCATGG - Intergenic
1019645417 7:2126284-2126306 CTAGGTGGAGTCTTCAACCTGGG - Intronic
1024043992 7:45575128-45575150 CTTGCTGGTCACAGCCACCTTGG + Exonic
1026469071 7:70679318-70679340 CTCTCTGGGCACTTCCCCCTTGG - Intronic
1029605855 7:101599028-101599050 CTGGCTGGTCCCTTCCACCAGGG - Intergenic
1029960995 7:104689230-104689252 CTACTTGGACACTGCCACCTTGG - Intronic
1032351325 7:131166524-131166546 CTCGCTGGGCACTGCCACCCTGG + Intronic
1035511250 8:186094-186116 CTGGATGGCCACTTCCACCATGG + Intergenic
1038959104 8:32498967-32498989 CTCCCTGGACAGTTCCAGCTGGG - Intronic
1039047652 8:33464574-33464596 CTAGGTGGGTCCTTCCACCTTGG - Intronic
1046779752 8:118202504-118202526 CAAGCTGGCCACTGCCTCCTGGG - Intronic
1056896783 9:90558933-90558955 CTATCTGCACACTTCCCCTTTGG - Intergenic
1057970799 9:99555464-99555486 CCAGCTGGACACTAAGACCTGGG - Intergenic
1057976224 9:99608924-99608946 CTAGCTGATCACTTCCATCCTGG - Intergenic
1058776571 9:108289981-108290003 CTAGGTGGACCCTTACAGCTTGG - Intergenic
1058824088 9:108759373-108759395 CAAGCTAGACACATCCTCCTTGG + Intergenic
1062756671 9:138300525-138300547 CTGGATGGCCACTTCCACCATGG - Intergenic
1187441704 X:19326640-19326662 CTAGATTAACACTTCCAGCTGGG - Intergenic
1195288542 X:103409193-103409215 CTAGCTAGCCCCTTCCACCAGGG - Intergenic
1196323941 X:114379096-114379118 ATAGATGGACATTTCCAGCTGGG - Intergenic
1202192281 Y:22257790-22257812 CTAACTGGCCACTTCTCCCTGGG + Intergenic
1202242621 Y:22787030-22787052 CTATCTTGACACTTGCCCCTGGG + Intergenic
1202395608 Y:24420780-24420802 CTATCTTGACACTTGCCCCTGGG + Intergenic
1202475177 Y:25249312-25249334 CTATCTTGACACTTGCCCCTGGG - Intergenic