ID: 966809147

View in Genome Browser
Species Human (GRCh38)
Location 3:183827969-183827991
Sequence TCCCTGGCCCGTGGGCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 238}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966809147_966809156 27 Left 966809147 3:183827969-183827991 CCAAGAGGCCCACGGGCCAGGGA 0: 1
1: 0
2: 1
3: 19
4: 238
Right 966809156 3:183828019-183828041 GGGTCCCCAGAGAAGCCAAGAGG 0: 1
1: 0
2: 1
3: 22
4: 241
966809147_966809152 -6 Left 966809147 3:183827969-183827991 CCAAGAGGCCCACGGGCCAGGGA 0: 1
1: 0
2: 1
3: 19
4: 238
Right 966809152 3:183827986-183828008 CAGGGAGTGCATGGCCTTGAAGG 0: 1
1: 0
2: 4
3: 33
4: 262
966809147_966809154 7 Left 966809147 3:183827969-183827991 CCAAGAGGCCCACGGGCCAGGGA 0: 1
1: 0
2: 1
3: 19
4: 238
Right 966809154 3:183827999-183828021 GCCTTGAAGGCAGTGATCGCGGG 0: 1
1: 0
2: 0
3: 7
4: 148
966809147_966809153 6 Left 966809147 3:183827969-183827991 CCAAGAGGCCCACGGGCCAGGGA 0: 1
1: 0
2: 1
3: 19
4: 238
Right 966809153 3:183827998-183828020 GGCCTTGAAGGCAGTGATCGCGG 0: 1
1: 0
2: 1
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966809147 Original CRISPR TCCCTGGCCCGTGGGCCTCT TGG (reversed) Intergenic
900161368 1:1225531-1225553 TCCCAGGCCCGTCCACCTCTGGG - Intronic
900360218 1:2284700-2284722 TCCCTGGCCCCTGGGTGGCTGGG + Intronic
900621274 1:3588613-3588635 TCCCTGGGCCGTGGGTGCCTGGG + Intronic
900646550 1:3711418-3711440 TCTCTGCCCCGAGGGCCTCCTGG - Intronic
900684408 1:3938954-3938976 GCCCTGGTCAGTGGGGCTCTTGG + Intergenic
902334535 1:15747445-15747467 TTCCTCCCCCTTGGGCCTCTGGG - Intronic
902628117 1:17688600-17688622 TCCCTGGCCCGAGGGCCCTTTGG - Intronic
902809006 1:18877769-18877791 GGCCTGGCCCGTGGGTCTCTGGG - Intronic
903063150 1:20684192-20684214 GCCCTGGCCTGTGGGCCCTTGGG + Intronic
903445243 1:23418768-23418790 TCCCTGGATCATTGGCCTCTTGG + Intronic
903831555 1:26178228-26178250 TCCCTGGCCCCAGGGCCAGTGGG + Intronic
904143197 1:28369749-28369771 TACCTGGCCCGTTGGCCGCCAGG - Intronic
904251419 1:29227254-29227276 TGCCTGGCCCCTGGGTTTCTGGG + Intronic
906165169 1:43680667-43680689 TCCTTGGCTCCTGGACCTCTAGG + Intronic
906284268 1:44576466-44576488 TCCCTGGCCTTTGGGCATGTAGG + Intronic
906448494 1:45923214-45923236 TCCCAGGGCAGTGGGCCTGTAGG + Intronic
906954190 1:50358893-50358915 CCCCTGCCCCGTGTGGCTCTCGG - Intergenic
907546321 1:55262952-55262974 TCCCAGCCTCTTGGGCCTCTGGG + Intergenic
908564395 1:65339808-65339830 TCCCTCACCCCTGGGCTTCTGGG + Intronic
909514308 1:76490070-76490092 TCCCTGCCCCGACAGCCTCTGGG + Intronic
912473863 1:109923736-109923758 GTCCTGGCCAGTGGGCCTCACGG - Exonic
912959217 1:114180659-114180681 CCCCTGACCCCTGGGCCCCTCGG + Intergenic
915346509 1:155200203-155200225 TTCCTGGCCAGTTGTCCTCTGGG - Intronic
915606218 1:156952991-156953013 TCCCTTTCCCATGGGCCACTTGG + Intronic
918045247 1:180937355-180937377 TCCCTGGCCCCTGGGCCTGTTGG + Intronic
920184597 1:204152090-204152112 GCCCCGGCCCGCGGGCCGCTGGG + Intergenic
923039880 1:230312168-230312190 TCCCAGGGCTGTGGGCCTTTGGG - Intergenic
923095604 1:230773018-230773040 TCCATGGCCCCTGAGCTTCTGGG + Intronic
924423647 1:243931655-243931677 TCACAGGCCCCTGGGCCTCCTGG - Intergenic
1069110899 10:64444844-64444866 TCTCTGGCCCTTGGGCCTAGAGG + Intergenic
1069865480 10:71500320-71500342 TCCCTGCCCCCAGAGCCTCTGGG + Intronic
1069900135 10:71702262-71702284 TCCCTGGTGACTGGGCCTCTGGG + Intronic
1073332880 10:102682221-102682243 CCCCTGGACAGTGGGCCTCTTGG + Intronic
1075398148 10:122142569-122142591 TCCAGGGTGCGTGGGCCTCTGGG - Intronic
1075999819 10:126905649-126905671 TCCCCGGCCCGGCGGCCGCTCGG - Intronic
1076861756 10:133141194-133141216 TGCCTCCCCCGGGGGCCTCTGGG + Intergenic
1077143026 11:1033195-1033217 TCCATGGCCCGTGGGGCTCGAGG + Intronic
1077413734 11:2415012-2415034 CTTCTGGCCCGTGGGCCGCTTGG + Exonic
1077454578 11:2670854-2670876 TCACTGGCCAGTGGGCCACTGGG + Intronic
1078326490 11:10385742-10385764 TTCCTGGCCCTTGGCCCCCTCGG - Intronic
1081993417 11:47349583-47349605 TCCCTGGCCCCCAGGCCTCCGGG + Intronic
1083173639 11:60936638-60936660 ACCCTGGCCCCTGGCCCTCCTGG + Exonic
1083878534 11:65537243-65537265 TCCCTGGCACGTAGGCCTCATGG + Intronic
1084213078 11:67632753-67632775 GCCCTGGCACCTGGGCCTCTTGG + Intronic
1084215749 11:67646032-67646054 ACCCCTGCCCGTGGCCCTCTTGG + Intronic
1088676010 11:112194141-112194163 TCTCTGGCCTGATGGCCTCTGGG + Intronic
1090184137 11:124725299-124725321 TCCATTCCCCCTGGGCCTCTGGG - Intergenic
1091259544 11:134223826-134223848 GCCCTGGCCCCCGGGCCTCCCGG + Intronic
1092053602 12:5490894-5490916 TCCCTCGCCCGTGTGCGTCAAGG + Intronic
1092297445 12:7211629-7211651 TCCCTGTTCTCTGGGCCTCTGGG + Intronic
1092304429 12:7284232-7284254 TCCCTGACCCCTGTGCCTCCTGG + Intergenic
1096215747 12:49796683-49796705 AGCCTGGCCTGTGGGCCTCTGGG + Exonic
1097682071 12:62658335-62658357 TCCCTGGCCCTAGTTCCTCTTGG + Intronic
1099236040 12:80083734-80083756 TCCCTGACCCCTGTGCCTCCTGG - Intergenic
1100449383 12:94690758-94690780 TCCCTGAGCAGTGGGCCTCCTGG - Intergenic
1102797424 12:115700816-115700838 TCCCTGGCGCTCTGGCCTCTGGG - Intergenic
1102871649 12:116418711-116418733 TCCCTGGCAGCTGGGCCTCCAGG + Intergenic
1107877313 13:44802185-44802207 TCCCTGGTCTGGGGCCCTCTTGG - Intergenic
1108364755 13:49698672-49698694 TCCCTGGCCAGTGGACCATTTGG - Intergenic
1110342877 13:74413667-74413689 ACCCTGGCCCTTGGCCCCCTTGG + Intergenic
1113606502 13:111611218-111611240 ACACTGGACCATGGGCCTCTGGG + Intronic
1113679485 13:112233347-112233369 CACCTGGCCAGTGGGCCTGTGGG - Intergenic
1113950078 13:114066868-114066890 TCCCTGGCCTGGGGTGCTCTGGG + Intronic
1114492904 14:23114280-23114302 TCCCTGCCCCTTGGTCCTCCTGG - Intergenic
1117338013 14:54771515-54771537 TCCCTGGCCCCAAGCCCTCTGGG + Intronic
1118755947 14:68843763-68843785 TCCCGGGCCTGTGGGCTTCTGGG - Intergenic
1118920964 14:70149678-70149700 TCACTTGCCAGTGGGACTCTGGG - Intronic
1119226447 14:72947882-72947904 TCCCTGGCCTCTGGGACCCTTGG + Intronic
1120899824 14:89566074-89566096 TTCCTGGCCGGTGGGCTCCTCGG + Intronic
1122599657 14:102914963-102914985 TCCCTGGCCCCTGTGGCACTTGG + Intergenic
1122824206 14:104361829-104361851 TCCCTGGCCAGTGGGCTCCAAGG - Intergenic
1122974560 14:105165769-105165791 GCCCAGGCCCGTGGGGCTTTTGG - Intronic
1123041543 14:105492265-105492287 GCCCAGGCCCGAGTGCCTCTGGG + Exonic
1123053392 14:105558701-105558723 TCCCTGGCCCGGCAGCCTCCTGG - Intergenic
1123061678 14:105597380-105597402 TCCCAGGCCCCTGGGTCTCCGGG - Intergenic
1123077969 14:105679115-105679137 TCCCTGGCCCGGCAGCCTCCTGG - Intergenic
1123086415 14:105719110-105719132 TCCCAGGCCCCTGGGTCTCCGGG - Intergenic
1123432457 15:20230146-20230168 TCCCTGTCACCTGGGCTTCTAGG + Intergenic
1125731091 15:41893211-41893233 GCTCTGGCCAGTGGGCCTCCGGG - Intronic
1126835127 15:52654970-52654992 TGCCTGGCCCATGGGCCAGTAGG - Intronic
1128309761 15:66622523-66622545 GCCCTGGCGCGGGGGCATCTAGG - Intronic
1129191687 15:73941336-73941358 TCCCTGGGGCCTGGGCCTCATGG - Intronic
1129451089 15:75651763-75651785 TCCCTGGCCCTTGGGCCCTGAGG + Intronic
1130918043 15:88321360-88321382 TCTCTGAGCCGTGGGCCTCGAGG + Intergenic
1131017079 15:89066769-89066791 TGGCTGGCCCGTGGCTCTCTTGG - Intergenic
1132147395 15:99436891-99436913 GCCCTGGCCCATGGGTCACTAGG - Intergenic
1132203355 15:99970079-99970101 TCTCTGCCCCGTGGGGCTGTGGG + Intergenic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132557440 16:578822-578844 CCTTTGGCACGTGGGCCTCTCGG + Exonic
1132687629 16:1168905-1168927 ACCCTGGCCTGTGAGCCTCTAGG + Intronic
1133333638 16:4991969-4991991 TACGGGGCCCGTGGGCCTCCAGG - Exonic
1135003840 16:18801281-18801303 TGCCTGGCCCTCGGGCTTCTTGG - Intronic
1135573625 16:23568070-23568092 TCCCTAGGCTGTGGGGCTCTTGG + Intronic
1136541182 16:30928345-30928367 TCCCTGGGACGGGGGCTTCTGGG + Intronic
1136852180 16:33620991-33621013 TCCCTGTCACCTGGGCTTCTAGG - Intergenic
1137568452 16:49549185-49549207 TCCTGGGGCCGTGGGGCTCTTGG + Intronic
1137767870 16:50991696-50991718 TCCCTGGCCCATGGCCCGATGGG + Intergenic
1138531275 16:57635647-57635669 TCCCTGGGCCGTGAGGCTTTGGG + Intronic
1139047575 16:63081326-63081348 CCCCTGGCCCATGGGCCACTTGG - Intergenic
1139348828 16:66322687-66322709 TCCCTGCCCCGTGGGTCACAGGG - Intergenic
1141275511 16:82584295-82584317 CCCCTGCCCTGTGAGCCTCTTGG + Intergenic
1142112831 16:88341304-88341326 GCCCTGGCCCATGCGCCTCCTGG - Intergenic
1142350176 16:89576093-89576115 GCCCCGGCCCGGTGGCCTCTCGG - Intronic
1142589729 17:997442-997464 TCCCAGGCGCGTGGTCTTCTCGG - Intronic
1143101352 17:4506419-4506441 TCCCTGGCCCCTGGTGGTCTTGG + Intronic
1143476774 17:7207644-7207666 TCCCAGGCGTGGGGGCCTCTTGG + Intronic
1143958920 17:10697900-10697922 GCCCAGTCCCGTGGGTCTCTAGG - Intronic
1145995639 17:29103411-29103433 TCCCTGGCCCCTGGCCCTGAAGG + Intronic
1146668144 17:34718402-34718424 CCCCTGGCCTGTGGGGATCTGGG - Intergenic
1147869741 17:43578954-43578976 CCCCTGGCCCGTAGGTCCCTAGG + Intronic
1148185131 17:45637494-45637516 CCACTGGCCTGTGGGGCTCTGGG - Intergenic
1148547029 17:48526974-48526996 ATCCTGGCCCCTGGGCATCTGGG + Intergenic
1150824505 17:68462826-68462848 TACTTGGCCCGTGGCCCTCTTGG - Intergenic
1151555047 17:74842580-74842602 TCCGGGGCCTGGGGGCCTCTGGG - Exonic
1152694722 17:81738419-81738441 TCCCTGGGGCTTGGGCCTCCAGG - Intergenic
1154500038 18:14991574-14991596 TCCCTGCCCCATGGGACCCTGGG + Intergenic
1157555317 18:48609762-48609784 TCCCTGTCCCTGGTGCCTCTAGG + Intronic
1158137556 18:54224126-54224148 TCCGTGGCCCGGGGTCCCCTGGG + Exonic
1160820353 19:1054937-1054959 TCCCTGGCCAGGGAGCCTCAGGG + Intronic
1161186830 19:2926830-2926852 TCCCTGCCCCGGGGGCTTGTGGG + Intergenic
1161272667 19:3398619-3398641 GCCCGGGTCCGAGGGCCTCTGGG - Intronic
1161324743 19:3658152-3658174 TCCCTGGCCCGAGAGCACCTCGG - Intronic
1161469422 19:4448868-4448890 ACCCTGGACGATGGGCCTCTCGG - Intronic
1161957727 19:7505906-7505928 CCCCGGGCCCGGGGACCTCTCGG + Intronic
1162321488 19:9973504-9973526 CCCCTGACCCCTGGGCATCTTGG - Intronic
1162341131 19:10092065-10092087 TCCCAGGCACGTGGGGCTCTAGG - Exonic
1163118199 19:15200588-15200610 TCCCTGTTCCTTGGGCCTCTGGG + Intronic
1163397222 19:17070683-17070705 TCCTGGGCCCCTGGGGCTCTAGG - Intronic
1163821496 19:19498924-19498946 CCCCTGGACCCTGAGCCTCTCGG - Intronic
1164302053 19:23971691-23971713 GCGCTGGCCAGTGGGCCGCTTGG - Intergenic
1164415418 19:28043222-28043244 TCCCAGTCCCTTGGGACTCTGGG - Intergenic
1166048807 19:40245872-40245894 GCCCTGGCCCTGGGGCCACTTGG - Intronic
1166288186 19:41845236-41845258 TCCCTGCCTCGCGGGCCCCTTGG + Intronic
1166391289 19:42410278-42410300 CCCCTGCCCCGTGCCCCTCTGGG - Intronic
1166709279 19:44926647-44926669 CCCCTGGCCCGTGGGCGTTGGGG - Intergenic
1168407877 19:56120429-56120451 GCCCTGCCCCGTGGGCCACGCGG + Intronic
926047526 2:9720733-9720755 CCCCTGGCCTGTGGTCCTCAAGG - Intergenic
926144130 2:10386519-10386541 TCCCAGGGCCCTGGGCCACTTGG - Intronic
926483389 2:13427253-13427275 TCCCTGGCCCCCGTGCCTCCTGG - Intergenic
926694333 2:15760606-15760628 GCCCTTGCCCGTGGGGCCCTCGG + Intergenic
931923044 2:67041609-67041631 TCCCTGGCCAATGGGCCCCGAGG + Intergenic
935398232 2:102632963-102632985 TTCCTGGCCAGTGGGTCTCCAGG - Intronic
939838408 2:147157085-147157107 GCCCTGGCTCGTGAGCCTCTAGG - Intergenic
940373314 2:152925586-152925608 TTTCTGGCCCTTGGCCCTCTGGG + Intergenic
947564461 2:231185309-231185331 TCCCTGGCCGGTGGCTCTCACGG + Intergenic
948030264 2:234811988-234812010 TCCTTGGCACATGGCCCTCTTGG + Intergenic
1168997952 20:2146682-2146704 TCCCTCCCCCGTGGCTCTCTGGG - Exonic
1169345644 20:4825986-4826008 TTCCTGGGCCATGAGCCTCTTGG - Intergenic
1172478094 20:35253575-35253597 TCCCTGCCCTGTGACCCTCTGGG - Intronic
1174194834 20:48765804-48765826 TCCCTGGGCCGTGGGCTGTTAGG + Intronic
1174471998 20:50768152-50768174 TCCCTGGGCAGTGAGCATCTTGG + Intergenic
1175279565 20:57794055-57794077 TCCCTCGCCCCTGGGTTTCTTGG + Intergenic
1175936197 20:62515208-62515230 TCCCCGGCCCCGGGGCCTCAGGG - Intergenic
1178702395 21:34844732-34844754 GCCCTGCCCCCTGGGCCTCGGGG + Intronic
1178952248 21:36994611-36994633 ACGCTGGCCCGCGGGCGTCTTGG + Intergenic
1179482055 21:41684788-41684810 TCCCTGCCCCGGGGCCATCTCGG - Intergenic
1180843026 22:18968045-18968067 TCCCTTGCCCGTTGGGCCCTGGG + Intergenic
1181014671 22:20062198-20062220 TTCCTTGCCCGTAGGCCTCAAGG + Intronic
1181162427 22:20966433-20966455 TGCCTGGCCCCTGCGCCTGTCGG - Intronic
1183190368 22:36318578-36318600 TCTCTGCCCCGTGGGGCTCAGGG - Intronic
1183368223 22:37418335-37418357 TCCCTGGCCCCTGAGCCCCATGG - Intronic
1184002865 22:41688270-41688292 TCCCTGGCGCGTGTGACTCGCGG + Intronic
1184416012 22:44352250-44352272 TCCCTGACCAGAGAGCCTCTGGG - Intergenic
1184478781 22:44735613-44735635 TCCCTTGACGGAGGGCCTCTGGG + Intronic
1185081310 22:48710821-48710843 TCCCTTTCCCTTGGGCCTCACGG + Intronic
950182893 3:10927541-10927563 ACCCGGGCCCGTCTGCCTCTTGG + Intronic
950765023 3:15267157-15267179 TGCCAGGCCCGTGAGGCTCTAGG + Intronic
953690081 3:45110524-45110546 TCCCTGGACTTTGGGCATCTTGG + Exonic
954224120 3:49171795-49171817 CCCCTGGCAGGAGGGCCTCTTGG - Intronic
954661162 3:52227624-52227646 TCCCTGGTCCAAGGGACTCTGGG - Intergenic
955400305 3:58586765-58586787 TCCCTGGCCAGTCCGCCGCTGGG - Intronic
959479422 3:106853565-106853587 TCCCTGACCCCTGTGCCTCTTGG + Intergenic
959511883 3:107222838-107222860 TGCCTGGCACATAGGCCTCTTGG - Intergenic
960949840 3:122992248-122992270 CCCCTGACCCGTGGGCTGCTGGG - Intronic
961333753 3:126158064-126158086 ACCCTGGCCCCTGCGCCTCCTGG + Intronic
961371598 3:126434991-126435013 TCCCTGGCCTGTGGGCAGCCCGG + Intronic
961718926 3:128879370-128879392 GCCCTGGGCCGCGGGCATCTCGG - Intergenic
961821377 3:129577367-129577389 CCCCTGGGCCGTGGGCGCCTGGG - Intronic
966809147 3:183827969-183827991 TCCCTGGCCCGTGGGCCTCTTGG - Intergenic
967329495 3:188276436-188276458 TTCGTGGCCCTGGGGCCTCTGGG + Intronic
967425362 3:189320791-189320813 TCCCTTGCCCGTGGGAGTATTGG + Exonic
969212227 4:5696557-5696579 TCCCTGGCTCCTGAGCCTCATGG - Intronic
971256724 4:25021287-25021309 TCCCTGTCCCTTGGGCTTCATGG + Intronic
971504401 4:27350422-27350444 TCCCGGGCAGGTAGGCCTCTGGG - Intergenic
972245672 4:37243974-37243996 TCCCGGGCCCGTCGGCCGCCAGG - Intergenic
977295438 4:95203958-95203980 TCCTTGGCCCCTGGTCATCTAGG - Intronic
982235472 4:153248068-153248090 TCACTGGCGCGTCCGCCTCTGGG + Intronic
982528127 4:156505505-156505527 TTCCTGCCCCGTGTGGCTCTCGG - Intergenic
984146313 4:176065820-176065842 TAGCTGTCACGTGGGCCTCTGGG + Intronic
985520310 5:371055-371077 CCCCTGGCCCTCAGGCCTCTGGG - Intronic
986299428 5:6466413-6466435 GCTGTGGCCCGTGGGCCTCCTGG + Intronic
986734192 5:10655894-10655916 TCCCTGGACCGTGGCCCTCCAGG - Intergenic
987927863 5:24365049-24365071 TCCCTGGCCCATGGGCTGCAGGG - Intergenic
993056899 5:82991650-82991672 TCTCTGGCTCCTGGGCTTCTGGG - Intergenic
993073937 5:83202077-83202099 TGCCTGGCTCTTTGGCCTCTGGG + Intronic
994133691 5:96261118-96261140 TACCTGGCCAGTGGGCTTCATGG + Intergenic
995241375 5:109888280-109888302 TCCTGGGCCCGTGGTCCCCTTGG + Intergenic
996079900 5:119246225-119246247 TGCCTGGTCAGAGGGCCTCTAGG + Intronic
997232657 5:132255804-132255826 TTCCTGGCCCCTGAGTCTCTGGG - Intronic
997262415 5:132475165-132475187 TCTCTGGCTCTGGGGCCTCTGGG + Intronic
997735498 5:136209762-136209784 TCTCTGGCCTGCCGGCCTCTGGG + Intergenic
999192615 5:149759798-149759820 CCCCTGGCCCAGGGGGCTCTTGG - Intronic
1000388872 5:160701929-160701951 CCCCTCTCCCGAGGGCCTCTTGG + Intronic
1002102848 5:176865844-176865866 TCCCTGCCCCCTGGCCTTCTGGG - Intronic
1002714234 5:181216502-181216524 TCCTTGGCCACTGGGACTCTGGG - Intergenic
1003212503 6:4079584-4079606 GACATGGCCAGTGGGCCTCTGGG + Exonic
1004342330 6:14818635-14818657 TCCCTGGGCAATGTGCCTCTGGG - Intergenic
1006211022 6:32394921-32394943 TCCATGGCACGTGGGGCTGTGGG + Exonic
1006630976 6:35429304-35429326 TCCCTTAGCTGTGGGCCTCTGGG - Intergenic
1007772299 6:44201510-44201532 TCACTGGCCTGTTGTCCTCTGGG - Intergenic
1007787010 6:44286377-44286399 TCGCTGGCCCGTGTGCCACGTGG - Exonic
1012030050 6:94048372-94048394 TCCCTCAACCCTGGGCCTCTAGG - Intergenic
1017663468 6:156696076-156696098 TGCCTGGACCCTCGGCCTCTGGG + Intergenic
1018585142 6:165349686-165349708 TTTCTGCCCCTTGGGCCTCTGGG - Intronic
1019215103 6:170438502-170438524 TCCCCGGCCTCTGTGCCTCTCGG + Intergenic
1019331227 7:461829-461851 TTCCTCACCCTTGGGCCTCTTGG - Intergenic
1019353200 7:564750-564772 GCCCTGGGCCCTGGGCCTGTTGG - Intronic
1019513031 7:1427704-1427726 TCCCTGTCCTCTGGGCCTCCAGG + Intergenic
1020005970 7:4783956-4783978 CCCCTGACCCGTGTGGCTCTGGG + Intronic
1021355167 7:19645095-19645117 TCCCTAACCTGTTGGCCTCTAGG + Intergenic
1024577443 7:50775988-50776010 TCCCTGGGCCTTGGTACTCTGGG + Intronic
1026849399 7:73715654-73715676 TGCCTGGCCTCTGCGCCTCTTGG - Intronic
1028163136 7:87508577-87508599 TCCCTGGGCTGTGGTCCTATGGG - Intronic
1029664820 7:101988420-101988442 TTCATGGGCTGTGGGCCTCTCGG + Intronic
1029877237 7:103767062-103767084 TCATTGGCCTGTGGGCTTCTTGG - Intronic
1030647616 7:112081035-112081057 TCCGTGGCCTGTGGGCTACTTGG - Intronic
1032504799 7:132426939-132426961 GCTCTGGCCTGTGGGACTCTAGG - Intronic
1036442478 8:8793724-8793746 TCCCTGGCCAGTGGGGCCTTAGG - Intronic
1036626804 8:10479255-10479277 CTCCTGGCACGTGGGTCTCTGGG - Intergenic
1039408082 8:37329626-37329648 TCCCTTGCCCAGGGGCCTCCTGG - Intergenic
1040947101 8:52895073-52895095 TCCTTGGCCAGTGGGTTTCTCGG - Intergenic
1041441241 8:57899180-57899202 TCCTTGGCCCCTGGTCATCTAGG + Intergenic
1041928837 8:63265969-63265991 TCCCTGGATTGAGGGCCTCTGGG + Intergenic
1044605222 8:94042186-94042208 TACCTGGCCCTTTGGCCTTTTGG + Intergenic
1045599158 8:103693729-103693751 TCCCTGGCCCCTGGGTTTGTTGG + Intronic
1049503112 8:142978630-142978652 GCCCTGGCCCCTGGTCCTGTGGG - Intergenic
1049606637 8:143532685-143532707 GCCTTGGCCAGTGGGCTTCTGGG - Intronic
1052821354 9:33139968-33139990 GCCCCGCCACGTGGGCCTCTCGG + Intronic
1053647520 9:40131902-40131924 TCCCTGCCCCATGGGACCCTGGG - Intergenic
1053758208 9:41331941-41331963 TCCCTGCCCCATGGGACCCTGGG + Intergenic
1054328498 9:63729856-63729878 TCCCTGCCCCATGGGACCCTGGG - Intergenic
1054537059 9:66244268-66244290 TCCCTGCCCCATGGGACCCTGGG + Intergenic
1055397498 9:75890932-75890954 TCTCCGGCCCGTGGGGCGCTCGG - Exonic
1057874349 9:98742707-98742729 TCACAGGCACCTGGGCCTCTTGG + Intronic
1057975833 9:99605181-99605203 TCCCAGGCACGTGGACCTCTGGG + Intergenic
1060229498 9:121816112-121816134 TCACTGGCCCGTGGTCATTTAGG + Intergenic
1061042121 9:128146316-128146338 TCCCTGGACCCCGGGGCTCTTGG - Intergenic
1061217844 9:129231980-129232002 TCCCTGGCATGTGGGGGTCTCGG + Intergenic
1061425149 9:130493847-130493869 TCCCTGGCCTTTAGGGCTCTCGG + Intronic
1062255192 9:135617561-135617583 TTCTTGGCCCTGGGGCCTCTCGG - Intergenic
1062463946 9:136673042-136673064 TGCCTGCACCCTGGGCCTCTAGG + Intergenic
1188506311 X:30888873-30888895 TCCCTCTCCCCTCGGCCTCTCGG + Intronic
1189478463 X:41375137-41375159 TCCCTGGGCCAACGGCCTCTCGG + Intergenic
1191974561 X:66858118-66858140 TCCCTGACCCCTGTGCCTCCTGG + Intergenic
1192110527 X:68359450-68359472 TCCCTGGGGCGTGAGCCTCCTGG + Intronic
1192545615 X:72010260-72010282 TCCCCTGCCCGTGAGCCTCAAGG - Intergenic
1197506066 X:127306480-127306502 TCCCTGACCCCCAGGCCTCTTGG + Intergenic
1197726483 X:129780279-129780301 TCCCTGTCCCGTTGCCTTCTAGG - Intronic
1200083604 X:153591911-153591933 TCCCTGGCCCGTGTGCCTTGTGG - Intronic