ID: 966809147

View in Genome Browser
Species Human (GRCh38)
Location 3:183827969-183827991
Sequence TCCCTGGCCCGTGGGCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966809147_966809152 -6 Left 966809147 3:183827969-183827991 CCAAGAGGCCCACGGGCCAGGGA No data
Right 966809152 3:183827986-183828008 CAGGGAGTGCATGGCCTTGAAGG No data
966809147_966809154 7 Left 966809147 3:183827969-183827991 CCAAGAGGCCCACGGGCCAGGGA No data
Right 966809154 3:183827999-183828021 GCCTTGAAGGCAGTGATCGCGGG No data
966809147_966809153 6 Left 966809147 3:183827969-183827991 CCAAGAGGCCCACGGGCCAGGGA No data
Right 966809153 3:183827998-183828020 GGCCTTGAAGGCAGTGATCGCGG No data
966809147_966809156 27 Left 966809147 3:183827969-183827991 CCAAGAGGCCCACGGGCCAGGGA No data
Right 966809156 3:183828019-183828041 GGGTCCCCAGAGAAGCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966809147 Original CRISPR TCCCTGGCCCGTGGGCCTCT TGG (reversed) Intergenic