ID: 966809562

View in Genome Browser
Species Human (GRCh38)
Location 3:183831453-183831475
Sequence CTGGAGTTTCAGATGAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 287}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966809562_966809566 5 Left 966809562 3:183831453-183831475 CCAGCCCTCATCTGAAACTCCAG 0: 1
1: 0
2: 0
3: 30
4: 287
Right 966809566 3:183831481-183831503 CAATTGTTACTTGTGTGACCTGG 0: 1
1: 0
2: 0
3: 12
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966809562 Original CRISPR CTGGAGTTTCAGATGAGGGC TGG (reversed) Intronic
900615954 1:3565724-3565746 CTGCAGTTTCCCAGGAGGGCAGG + Intronic
902323289 1:15683477-15683499 CTCGAGTCTCTGAGGAGGGCCGG + Intergenic
902470208 1:16643745-16643767 ATGGAGTTTGCCATGAGGGCTGG - Intergenic
902527940 1:17071395-17071417 CTGTACTTCCAGGTGAGGGCAGG - Exonic
902848864 1:19137088-19137110 CAGGAGTTCCAGATCAGGCCTGG + Intronic
903269522 1:22178661-22178683 CTGGGGTTTCAGAGGACAGCAGG - Intergenic
903569558 1:24294278-24294300 CTTGAGTTTAGCATGAGGGCCGG + Intergenic
903583589 1:24391025-24391047 CAGGAGTTTCAGATCAGCCCAGG - Intronic
905447513 1:38036686-38036708 CTGGAGTTAAAGGAGAGGGCAGG + Intergenic
905669724 1:39783678-39783700 CAGGAGGATCAGATGAGGCCAGG + Intronic
908643522 1:66251577-66251599 TAGCAGTTTCAGATAAGGGCAGG + Intronic
909047664 1:70729433-70729455 CTGCAGTTTCAAATGAGACCAGG + Intergenic
916079862 1:161225819-161225841 CTGGAGCTGCAGAGGCGGGCAGG - Intergenic
916706680 1:167357585-167357607 CTGGAGTTTGAGATGAGCCTGGG - Intronic
917043488 1:170831829-170831851 TTGGAGTTTCAGAAGTGGGGAGG - Intergenic
917846408 1:179024232-179024254 AAGGATTTTCAGGTGAGGGCAGG - Intergenic
920615436 1:207487836-207487858 CTGCAGGTGCAGATGAAGGCAGG + Intronic
921942473 1:220856430-220856452 CAGGAGTTGCAGATGAGCCCTGG + Intergenic
922162713 1:223090157-223090179 CTGGAGAGCCAGATGAGGGGAGG - Intergenic
922522604 1:226269500-226269522 CTAGAGCTTCAGGTTAGGGCAGG + Intronic
1062857588 10:786999-787021 CTGGGGTCTGAGAGGAGGGCGGG - Intergenic
1063427496 10:5961491-5961513 CTGGAGGCTCAGCTGAGAGCAGG + Intronic
1064114481 10:12566572-12566594 CTAGACTTTCAGATGAGGAAAGG + Intronic
1066189070 10:33038729-33038751 CTGGAGGATCAGTTGAGGCCAGG + Intergenic
1067012556 10:42728008-42728030 CTGGAGGGTCAGCTGAGGCCAGG + Intergenic
1067311035 10:45113880-45113902 CTGGAGGGTCAGCTGAGGCCAGG - Intergenic
1067478255 10:46579817-46579839 ATGGAGGTTCTGGTGAGGGCAGG + Intronic
1067616484 10:47761970-47761992 ATGGAGGTTCTGGTGAGGGCAGG - Intergenic
1067695096 10:48528756-48528778 CTGGTAGTTCACATGAGGGCTGG + Intronic
1072458609 10:95599341-95599363 CTGGAGTATCACTTGAGGACAGG - Intergenic
1073007900 10:100338814-100338836 CTGCAGGTTCAGATCTGGGCCGG + Intergenic
1074692165 10:116016113-116016135 ATGGATTTTCAGATGAGAGCAGG - Intergenic
1074777727 10:116778597-116778619 CTGGACTTTCTGATGAAGCCAGG - Intergenic
1075325735 10:121530924-121530946 CTGGAGATTCAGGTGAGGATGGG - Intronic
1075738451 10:124678717-124678739 CTGTGGATACAGATGAGGGCAGG + Intronic
1076691411 10:132225493-132225515 CTGGGGTTCCAGATGGGAGCTGG - Intronic
1079987131 11:27211157-27211179 CAGGAGTTTCAGATCAGCACAGG + Intergenic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1082634941 11:55583976-55583998 GTGGAGTTGAACATGAGGGCAGG - Intergenic
1083088914 11:60179804-60179826 GTAGAGTTTCTGAGGAGGGCAGG - Intronic
1083386188 11:62312126-62312148 CAGGAGTTTGAGATGAGGCTGGG - Intergenic
1084127780 11:67112148-67112170 CAGGAGTATCACATGAGGCCAGG + Intergenic
1084276031 11:68051405-68051427 CTGTAGTCTCAGGTGAGGGGAGG - Intergenic
1084506816 11:69573509-69573531 CTGGAGTTCAGGCTGAGGGCGGG + Intergenic
1084716713 11:70878885-70878907 CTGGAGCTGGAGGTGAGGGCAGG - Intronic
1085787077 11:79462526-79462548 CTAGATTTTCTGATGAGGGTGGG + Intergenic
1087180129 11:95133817-95133839 CTGAAGGTACAGATGAGGGTTGG + Intergenic
1089813606 11:121152564-121152586 CTGGAGATTCAGATGGGCGGTGG + Intronic
1090860868 11:130651309-130651331 CTGGAGGATCAGCTGGGGGCTGG - Intergenic
1091156993 11:133383210-133383232 CTGGAGTCTGAGCTGTGGGCAGG - Intronic
1091413771 12:262251-262273 CTGTAGAGTCAGATGAGGCCAGG + Intronic
1091999461 12:5020414-5020436 CTGGACTTTCTGAGGTGGGCTGG + Intergenic
1092696250 12:11174928-11174950 CTGGAGATTCATTTGAGGTCTGG - Intergenic
1094676878 12:32628908-32628930 CTGGTGTTTGAGATAAGGGTAGG + Intronic
1096245053 12:49980042-49980064 CTGCAGTTTCTAATGAGGCCTGG + Intronic
1096681222 12:53256659-53256681 CAGGAGTTTCAGATGAGCCTGGG - Intergenic
1097611385 12:61825539-61825561 CTGCACTTTCAGATGAGTGTTGG + Intronic
1097772585 12:63605401-63605423 ATGGAGTTTCAGGAGATGGCAGG + Intronic
1097799745 12:63900583-63900605 CGGGAGGATCAGATGAGGCCAGG + Intronic
1098209214 12:68145129-68145151 CTAGAGGTTCAGAGGAGGTCAGG - Intergenic
1098593996 12:72249476-72249498 CTGGAGTTTCAGATCAGCCTGGG + Intronic
1099523955 12:83696598-83696620 CTGGAGTTCCAGATGGGCGTGGG - Intergenic
1100870463 12:98905428-98905450 CTAGAGTTTCTGATGAGGGTAGG + Intronic
1101030282 12:100651490-100651512 GTGGAATTTCAGAAGAGGGAGGG - Intergenic
1101272618 12:103163467-103163489 CTTGTGTTTGAGCTGAGGGCTGG + Intronic
1103066154 12:117899263-117899285 CTGGAGTATCACTTGAGGCCAGG + Intronic
1104035448 12:125094108-125094130 CTGGAGTTGCTGATGAGGTGGGG + Intronic
1104198081 12:126560597-126560619 CAGGTGTTTCACATGAGGTCAGG + Intergenic
1104232181 12:126896293-126896315 CTGGAGTTTCTATTGAGGGCTGG - Intergenic
1104551464 12:129761234-129761256 CTGGGGTCTAAGATGGGGGCTGG - Intronic
1106828469 13:33551417-33551439 TTGGATTTTCAGATTAGGGATGG + Intergenic
1108875948 13:55051301-55051323 CTGGAGATTCAGAAGAGAGAAGG + Intergenic
1109649501 13:65308127-65308149 CTGTTGTTTCAGGTGAGGGTGGG + Intergenic
1110046737 13:70841629-70841651 CTGCATTTTCAGGTGGGGGCAGG - Intergenic
1110868328 13:80422350-80422372 CTGGACTTTGAAATTAGGGCTGG - Intergenic
1112412403 13:99175839-99175861 CTGGAGGATCACCTGAGGGCAGG + Intergenic
1114318680 14:21528571-21528593 CTGGACTTACAAATGAGGGAGGG + Intronic
1115450618 14:33543168-33543190 TTTGTGTTTCAGATGAGAGCTGG - Intronic
1118547942 14:66915334-66915356 CTAGATTTTCATATGAGAGCTGG - Intronic
1118698295 14:68407781-68407803 GGGGAGTTCCAGATGAGGGAGGG + Intronic
1119448748 14:74689535-74689557 ATGGAGATTCACATGAGGGAAGG - Intronic
1119592927 14:75907109-75907131 CTGGACTTTCAGATTATGGGAGG + Intronic
1121886610 14:97548794-97548816 CTGGAGATTCAGAGAAAGGCAGG + Intergenic
1122222962 14:100253116-100253138 CTGGAGTTTCCCTTGAGGACAGG - Intronic
1123914588 15:25010125-25010147 CAGGAGTTCCAGATGAGCGTAGG + Intergenic
1125503192 15:40252278-40252300 CTGGAGAATCAGCTGAGCGCCGG - Exonic
1125585348 15:40815639-40815661 CTGGAGTTTCAGGGCAGGCCTGG + Exonic
1126227738 15:46290327-46290349 CCAGAGGTTCATATGAGGGCAGG + Intergenic
1127396406 15:58546997-58547019 GTGAAGTTTGGGATGAGGGCTGG - Intronic
1128456480 15:67834228-67834250 CAGGAGTTTCAGAAGTGGACGGG - Exonic
1129859142 15:78846922-78846944 CTGGAGTTCCAGATGGGCGTGGG + Intronic
1130083059 15:80751512-80751534 CTGGAGTATCACTTGAGGCCAGG + Intronic
1130354492 15:83117294-83117316 GTGGAGTTTCAGATGCTGGCAGG + Intronic
1130702896 15:86203497-86203519 GTGGTGTTTCAGATGAGGAGTGG + Intronic
1130940963 15:88508681-88508703 CTGCAGTTTCAGAGGAGGGGTGG + Intergenic
1132693935 16:1193839-1193861 CTGGAGTGACAGGTGGGGGCAGG + Intronic
1133363872 16:5195833-5195855 TTGGAGTTTCAGATGTGAGAGGG + Intergenic
1133624921 16:7562360-7562382 CTGAAGTTACAGAAGAGGGCAGG + Intronic
1134059411 16:11190082-11190104 CAGGAGTTTGAGATGAGGCAGGG - Intergenic
1134109837 16:11508329-11508351 CAGGAGTTTCGGAGGAGGCCTGG + Intronic
1134243032 16:12519778-12519800 CAGGAGTATCACCTGAGGGCAGG + Intronic
1134263314 16:12671551-12671573 CTGGAGATTCACCTGTGGGCAGG + Intronic
1135112623 16:19702474-19702496 TTGGACTTTCACATGAGGTCGGG + Exonic
1135658062 16:24268891-24268913 CTGGAGTTGAGGATGAGGGTAGG - Intronic
1135705091 16:24668098-24668120 CTGGAGTATCACCTGAGGTCGGG + Intergenic
1135721410 16:24821538-24821560 CTTGAGTTGCAGATGGGGTCAGG + Intronic
1138057753 16:53853477-53853499 CTGGAGATTCAGAAGAGAGGAGG - Intronic
1138183849 16:54961769-54961791 CTGGAGTCTCAGGGGAGGCCTGG - Intergenic
1138855069 16:60681130-60681152 GTGGAATTTCAAAAGAGGGCTGG - Intergenic
1141332142 16:83120595-83120617 CTTGAGCCTCAGATGAGAGCTGG - Intronic
1141717180 16:85733759-85733781 CTGGAGTCTCAGAGGAAGCCAGG + Intronic
1141996620 16:87640044-87640066 CTGGAGTTCCAGCTGAGGGGGGG + Intronic
1143039135 17:4019663-4019685 CTGGAGGTTCAGAAGAGGTAAGG - Exonic
1143509965 17:7390037-7390059 CTGGGGTTTTACAAGAGGGCTGG - Exonic
1144838459 17:18171026-18171048 CTGGAGCTGCAGATGAAGGAAGG - Intronic
1144946494 17:18972066-18972088 CAGGAGTTTCTGTTGAGTGCAGG + Intronic
1145304870 17:21668275-21668297 CTGAATCTTCAGATGAGGGGAGG + Intergenic
1146489679 17:33271370-33271392 CTGGAGCTCCAGAGGAGGTCAGG - Intronic
1146636365 17:34508465-34508487 CTGGAGATTCAGATGTGGGGAGG - Intergenic
1146744189 17:35313695-35313717 CTGAACTCTCAGGTGAGGGCAGG + Intergenic
1147332358 17:39706435-39706457 CTGGAGTTGCAGCTGAGGCATGG - Intronic
1147857773 17:43495483-43495505 CAGGAGTTTGAGATGAGCACTGG - Intronic
1148784946 17:50141434-50141456 CTGGAGTTTCTGATGGGAGGAGG - Intronic
1149516552 17:57285221-57285243 CCGGAGTTTCAGGGGAGGGAGGG + Intronic
1149816911 17:59734522-59734544 CAGGAGTTTCAGATGAGCCCAGG + Intronic
1149855584 17:60079555-60079577 CTAGAGTTTCAGATTCGGGCTGG + Intergenic
1151386004 17:73755820-73755842 CTGGAGCCTCAGCTGAGGCCTGG - Intergenic
1152103991 17:78318437-78318459 GTGGAGTTTCAGAGGTGGGGTGG - Intergenic
1152344699 17:79743879-79743901 CTGGATTTACAGAGGAGGACAGG - Intergenic
1153332556 18:3888907-3888929 CTGGATTTTCAGGAGAGGGTTGG + Intronic
1154055504 18:11009443-11009465 CTGGAGATTCAGCTGAAGGGAGG + Intronic
1156022563 18:32616736-32616758 GTGCAGTTTCAGATTAGGGATGG + Intergenic
1156516964 18:37688252-37688274 CTGGTGCTTGAGATAAGGGCAGG + Intergenic
1159433673 18:68387168-68387190 CTGGAGTATCACCTGAGGTCAGG - Intergenic
1159656131 18:71031650-71031672 CTGGAGTTCCAGGTGGGGGTGGG - Intergenic
1160603268 18:80030755-80030777 CAGGAGTTTCAGACCAGGCCTGG + Intronic
1160851098 19:1193106-1193128 CTGGGGTTTCAGGTGAAGCCTGG - Intronic
1160851124 19:1193204-1193226 CTGGGGTTTCAGGTGAAGGCTGG - Intronic
1160851828 19:1196372-1196394 CTGGGGTTTCAGGTGAAGTCCGG - Intronic
1160852252 19:1198186-1198208 CTGGGGTTTCAGGTGAAGTCCGG - Intronic
1161624035 19:5315571-5315593 CTGGAGTTCCAGATCAGGCAGGG - Intronic
1161793492 19:6374071-6374093 GGGGAGTTTGAGTTGAGGGCAGG + Intronic
1162955716 19:14096885-14096907 CTGAGGGTTCAGATGAGGGGTGG - Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163295031 19:16406266-16406288 CTGGCCTTTCACTTGAGGGCTGG + Intronic
1163624850 19:18383211-18383233 CTGGGGTTTTAGAGCAGGGCAGG - Intronic
1164145072 19:22507449-22507471 CTGGAGTTTCAGAGCAGGCTGGG - Intronic
1164793643 19:31008795-31008817 CTGGAGTTTCAGATCAGGCTGGG - Intergenic
1164857769 19:31538417-31538439 CTGGATTTACAGGTGAGGGTGGG - Intergenic
1165077550 19:33288664-33288686 TTGGAAGTTCATATGAGGGCTGG - Intergenic
1165860640 19:38907459-38907481 CTGGAGCTTCTCCTGAGGGCAGG + Exonic
926632034 2:15145506-15145528 CTGGAGTTCCAGTTGAGACCTGG + Intergenic
928419748 2:31128996-31129018 CTGGTGTTTCAGCAGAGGGAGGG + Intronic
929408288 2:41667790-41667812 CTGGAGTTTGAGAGAAAGGCAGG - Intergenic
930332300 2:50000833-50000855 CTGGAGGTACAGATGAGTTCTGG + Intronic
934511640 2:94948888-94948910 CCGTATTTTCAGATGAGTGCTGG - Intergenic
936920904 2:117687463-117687485 CTGGAAATACTGATGAGGGCAGG + Intergenic
937621913 2:123998251-123998273 ATAGAGTTTCAGATGGGGGCAGG - Intergenic
938575638 2:132600947-132600969 CTGGAGATGCAGAGGAGGGAAGG - Intronic
939255078 2:139732871-139732893 CTGCAGGTTCAGATGAGGCTAGG - Intergenic
939764319 2:146227201-146227223 CTGGAGGATCATTTGAGGGCAGG + Intergenic
940416715 2:153431425-153431447 GTGGCTTTTCAGATGAGAGCAGG + Intergenic
942626264 2:177903870-177903892 CTGGAGTTCCAGATGAAAGCAGG + Intronic
942909731 2:181228498-181228520 CAGGAGTTTCAGATCAGTGTGGG + Intergenic
945061809 2:205915919-205915941 CTGGATTATCAGATGAGCACAGG - Intergenic
945315971 2:208371017-208371039 CTGGTATTTCACATGAGAGCTGG - Intronic
946147290 2:217740723-217740745 CTGGGGTTTCAGTTGGGGTCAGG - Intronic
947007376 2:225527854-225527876 CAGGAGTTTGAGATGAGCCCAGG - Intronic
948951630 2:241256103-241256125 CTGGAGATTCAGTTAAGGCCTGG - Intronic
1168962818 20:1880587-1880609 CTGGAGGTTCAGAGCAGGGGAGG + Intergenic
1169366359 20:4995939-4995961 CCTGAGTTTCAGATGAGAGCTGG + Intronic
1169482720 20:5999898-5999920 CTGGCTTTGCAGATGAGGGAAGG + Intergenic
1171035085 20:21707555-21707577 CTGGAGTTTGCGGTGATGGCTGG + Intronic
1171098286 20:22354535-22354557 GTGGACTTCCAGATGGGGGCTGG + Intergenic
1171176132 20:23051596-23051618 GTGGAGCTTCAGATAAGGGCAGG + Intergenic
1171522379 20:25785715-25785737 CTGAATCTTCAGATGAGGGGAGG + Intronic
1171530128 20:25847660-25847682 CTGAATCTTCAGATGAGGGGAGG + Intronic
1171554448 20:26070168-26070190 CTGAATCTTCAGATGAGGGGAGG - Intergenic
1172641322 20:36442096-36442118 CTGGAGATACAGATTAGGGATGG - Intronic
1174375026 20:50120862-50120884 ATGGAGTTTCAGTTGGGGGCAGG + Intronic
1175609846 20:60341628-60341650 CTGGAGGATCACTTGAGGGCAGG + Intergenic
1176153234 20:63604136-63604158 CTGGAGGATCACATGAGGCCAGG + Intronic
1176662673 21:9653807-9653829 CTGGAGCTGCAGATGATGTCAGG + Intergenic
1178934427 21:36849581-36849603 CTAGAGTTTCTGCTGGGGGCAGG + Intronic
1183248446 22:36711468-36711490 CTGGAGTATCCCAGGAGGGCTGG + Intergenic
1183805646 22:40208282-40208304 CAGCAGTTTCAGTTGTGGGCTGG + Intronic
1185104312 22:48858564-48858586 CTGGTGTCTCAGATGAGGTCAGG + Intergenic
949862464 3:8518694-8518716 CTGGAGATAAAGATGAGAGCTGG + Intronic
950439761 3:13003208-13003230 CGGGAGTGTCACATGAGGCCAGG + Intronic
952033304 3:29170679-29170701 AGGGATTTTCAGATGAGGGGAGG + Intergenic
952598627 3:35050454-35050476 CAGGGGTGTCAGATGAGGCCAGG - Intergenic
953218134 3:40940433-40940455 CAGGAGTTACAGGTGAGGGAGGG - Intergenic
953552663 3:43916130-43916152 CTGGAGGATCAGTTGAGGTCAGG - Intergenic
953721757 3:45362241-45362263 CTGGAGATAAAGAGGAGGGCAGG - Intergenic
954299220 3:49690508-49690530 ATGGAGTTTGCCATGAGGGCTGG + Intronic
955212169 3:56952376-56952398 CTAGAGTTTCATCTGAGGCCTGG - Intronic
956068864 3:65426295-65426317 CTCGATTTCCAGATGAGGGAAGG + Intronic
957108716 3:75925182-75925204 CAGGAGTTTCAGATCAGCCCGGG + Intronic
958575574 3:95946533-95946555 CTGGAGGATCAGTTGAGGTCAGG - Intergenic
960314090 3:116155180-116155202 CTGGACTCTCTCATGAGGGCAGG + Intronic
960543738 3:118888782-118888804 CTAGTGTTTCAGATGATGGATGG + Intergenic
962747363 3:138406897-138406919 TTGGAGTTACAGAGGAGGGATGG - Intergenic
965232357 3:166070650-166070672 CTGTTGTTTCACATGAGAGCTGG - Intergenic
966473712 3:180320918-180320940 CTGGATTTTCAGATGACAGGTGG + Intergenic
966809562 3:183831453-183831475 CTGGAGTTTCAGATGAGGGCTGG - Intronic
968968523 4:3781624-3781646 GAGGAGTTTCATATGAGGGGAGG - Intergenic
969613986 4:8241793-8241815 CTGGGGACTGAGATGAGGGCCGG - Intronic
971265426 4:25092525-25092547 CTGGAGAATCAGAAGAGGTCGGG - Intergenic
971294225 4:25375182-25375204 GTGGAGTTCCAGATGTGGGCAGG - Intergenic
971709436 4:30092757-30092779 CTGGAGTTTCAGATGGGCGTGGG + Intergenic
972463453 4:39328843-39328865 CTGCAGTTTCAGATGAGATACGG + Intronic
973052148 4:45609854-45609876 GTGGAGTTGGACATGAGGGCAGG - Intergenic
974593844 4:63991133-63991155 CTGGAGATCCAGAGGAGGGAGGG + Intergenic
975487498 4:74950295-74950317 CTGGAGCTTCAGAGGAGGCATGG - Intronic
975854936 4:78614259-78614281 CTTTGGTTTCAGAGGAGGGCTGG - Intergenic
978264806 4:106810772-106810794 CTGGAGTATCACTTGAGGCCAGG - Intergenic
980022845 4:127730238-127730260 CTGGGCTTTCTGATGAGGGAGGG - Intergenic
981111009 4:140933460-140933482 TTGGATTTCCAGATGAGGGGTGG + Intronic
981442782 4:144801849-144801871 TTGGAGATTCAGAAGAGGGGAGG - Intergenic
982271227 4:153591147-153591169 CTGAAGTTTAACATGAGGCCAGG - Exonic
983534010 4:168838344-168838366 CTGGGGGCACAGATGAGGGCTGG + Intronic
984309558 4:178039692-178039714 CTGGGATTTCAGATGAGCCCTGG - Intergenic
985412665 4:189702374-189702396 CTGGAGCTGCAGATGATGTCAGG - Intergenic
986611579 5:9573181-9573203 CTGGAGGATCACATGAGGCCAGG + Intergenic
990494220 5:56330961-56330983 CTGCAGATTCAGATGTGGGAGGG + Intergenic
990672590 5:58149655-58149677 CTGGAATTTCATACCAGGGCGGG - Intergenic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
992237260 5:74723712-74723734 CTGTAGTACCAGATGAAGGCAGG - Intronic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
994919905 5:106030822-106030844 CAGGAGTTTCAGATGAGCCTGGG + Intergenic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
997878706 5:137571183-137571205 CTAGAGGCTCAGATGAGGGGTGG - Intronic
999296266 5:150461367-150461389 CTGTAATTTCAGCTGGGGGCAGG + Intergenic
999632224 5:153583004-153583026 CAGGAGTTTGAGATGAGGCTGGG - Intronic
999671332 5:153961064-153961086 CTGGATTGTCAGAAGAGGCCTGG - Intergenic
1000027353 5:157371061-157371083 CTGGAGTCCCAAATGAGGGCTGG + Intronic
1001656041 5:173351016-173351038 CTGAAGGTTCAGATGATTGCTGG + Intergenic
1001790140 5:174449269-174449291 CAGGAGTTTCAGATCAGCCCGGG + Intergenic
1002131595 5:177085525-177085547 CTTGAGATTCAGGTGAGGGATGG + Intergenic
1003693253 6:8375845-8375867 CTGGAGTATCAGTTGAGCCCGGG - Intergenic
1004858114 6:19772036-19772058 CTGAAGTCTCAGATGATTGCTGG + Intergenic
1006129258 6:31859497-31859519 CAGTATTCTCAGATGAGGGCAGG + Exonic
1006664343 6:35679758-35679780 CTAGAGACTCAGAAGAGGGCAGG + Intronic
1007227513 6:40325395-40325417 CTGGAGTTGCAGAGGAGGGTGGG + Intergenic
1007840495 6:44712285-44712307 CTGGCATTTCAGATGATGGGTGG + Intergenic
1007977661 6:46118042-46118064 CTGGAGCTTCAAATGTAGGCAGG - Intergenic
1009894248 6:69727417-69727439 TTGGATTTTCAGATTAGGGAGGG + Intronic
1017169172 6:151439885-151439907 CGGGAGGATCAGATGAGGTCGGG - Intronic
1017515633 6:155153377-155153399 CTGGAGGTTCATTTGAGGCCAGG + Intronic
1019271406 7:151073-151095 CCCGAGTTTGAGATGAGGACAGG + Intergenic
1020013705 7:4819482-4819504 CTGGAGTTTCGGGGCAGGGCAGG - Intronic
1020087228 7:5317038-5317060 CTGGCGTTTGGGAAGAGGGCTGG - Intronic
1020273909 7:6613787-6613809 CAGGAGTTTAAGATCAGAGCAGG - Intergenic
1020557119 7:9684168-9684190 TTGGAGTTTGATATGATGGCTGG + Intergenic
1022013779 7:26330809-26330831 CTGGAGTTTGAGACCAGGCCGGG + Intronic
1022535126 7:31093764-31093786 CTGGGGTCTCTGATGAAGGCAGG - Intronic
1023796924 7:43801203-43801225 CAGGAGTTTGAGATGAGGCTGGG - Intronic
1023823602 7:43993928-43993950 CTGGAGGATCATATGAGGCCAGG + Intergenic
1025282866 7:57640892-57640914 CTGAATCTTCAGATGAGGGGAGG + Intergenic
1025301849 7:57824526-57824548 CTGAATCTTCAGATGAGGGGAGG - Intergenic
1025664863 7:63576770-63576792 CTGGCGTTTGGGAAGAGGGCTGG - Intergenic
1028843887 7:95458759-95458781 CTGGAGTTTAAGATGAGCCTTGG - Intergenic
1029528581 7:101110466-101110488 CTGGAGTATCACTTGAGGCCAGG - Intergenic
1031332227 7:120480344-120480366 CAGGAGTTTCTGTTGGGGGCTGG - Intronic
1032281715 7:130508580-130508602 CTGGAGTTCCAGATGAGGATGGG - Exonic
1033008213 7:137590427-137590449 CAGGACTTTCAGATGAGAGCTGG - Intronic
1033150493 7:138910604-138910626 CTGGAGTTTGAGATGAGCCTGGG - Intronic
1033520265 7:142153495-142153517 CTGAAGTTTCAGAGGAAGCCAGG + Intronic
1033572849 7:142650142-142650164 CTGGAGTTTCCTTTGAGGGAAGG - Intergenic
1034207409 7:149329969-149329991 CTGGAGGTTCAGGTGTGGGGAGG + Intergenic
1034225567 7:149478054-149478076 CTTGTGTTTCAAGTGAGGGCAGG - Intronic
1035207875 7:157306338-157306360 CAGGAGTTTCACTTGAGGTCAGG + Intergenic
1035845771 8:2862600-2862622 TTGGAGTTTCCGCTGAGGGTTGG - Intergenic
1035845798 8:2862820-2862842 TTGGAGTTTCCGCTGAGGGCTGG - Intergenic
1039612041 8:38927876-38927898 CTGGAGCTGGAGATGACGGCTGG + Intronic
1040587417 8:48756749-48756771 TTGCAGTTTCAGATGAGGTCAGG + Intergenic
1041477101 8:58278799-58278821 CTGGAGCTCCAGATGCAGGCAGG - Intergenic
1042341425 8:67684112-67684134 CAGGAGTTTCACTTGAGGCCAGG - Intronic
1042371982 8:68002372-68002394 CAGGAGTATCAGTTGAGGTCAGG - Intronic
1042418711 8:68559438-68559460 GTGGAGTTTCTGAAGAAGGCAGG + Intronic
1043166329 8:76907490-76907512 CTTGAGTTTCAGATGAGATCAGG - Intergenic
1045430173 8:102106299-102106321 CTGGAGGATCACATGAGGTCAGG - Intronic
1045967150 8:108038191-108038213 CTGAAGTTATACATGAGGGCTGG - Intronic
1046163907 8:110403782-110403804 CTGGAGGATCACATGAGGCCAGG + Intergenic
1046983369 8:120360940-120360962 CTGGAGTTGCAGAGGAGGCAGGG - Intronic
1047373921 8:124278408-124278430 CTGGAATATTAAATGAGGGCGGG - Intergenic
1047486417 8:125334962-125334984 CAGGAGTTTGAGATGAGCGTGGG - Intronic
1048937927 8:139372373-139372395 CTGGATTTGCAGATGGGGGAAGG - Intergenic
1049178816 8:141209939-141209961 CTGGGCCTTCAGATGAGGGTGGG + Intronic
1050104098 9:2147616-2147638 CGGGAGTATCAGCTGAGGTCAGG + Intronic
1051315548 9:15826734-15826756 CTGGAGCCTCAGCTGAAGGCTGG - Intronic
1052075428 9:24135136-24135158 CTGGAGTTCCAGATGGGCGTGGG + Intergenic
1052434766 9:28412097-28412119 CTGGAGAATCAGAAGAGGGGAGG - Intronic
1057814543 9:98284983-98285005 CAGGGGTTTCAGATGTGGGGTGG + Intergenic
1060632044 9:125167816-125167838 CAGGAGTTTGAGATGGGGGGGGG + Intronic
1060958414 9:127661377-127661399 CTGGAGAGTAAGATGAGGGCAGG - Intronic
1061597566 9:131641839-131641861 CTGGAGTTTCAGCTGACGCGTGG - Intronic
1061625249 9:131837549-131837571 CTGGAGTTACAACCGAGGGCTGG + Intergenic
1203669926 Un_KI270755v1:612-634 CTGGAGCTGCAGATGATGTCAGG + Intergenic
1185970203 X:4654225-4654247 CTGGAGTTTCAGATCAGCCTGGG + Intergenic
1186080663 X:5928030-5928052 CTGGAGTTGCAGATGCGTGTAGG - Intronic
1188005019 X:25011206-25011228 CTGAAGTTTCAGGTGTGGACTGG - Intronic
1188287903 X:28351039-28351061 CTAAATTTTCAGGTGAGGGCTGG + Intergenic
1189024320 X:37375680-37375702 CTATAGTTTCACCTGAGGGCAGG + Intronic
1190190443 X:48272560-48272582 CTGGAGTATCACTTGAGGCCTGG + Intronic
1190516828 X:51232485-51232507 CTGGAGTTACAGCAGATGGCTGG + Intergenic
1191095190 X:56666019-56666041 CTGGAGTTTGAGATGAGATTTGG - Intergenic
1191703590 X:64069602-64069624 CTGGAGTTTCAGATAAGTGAAGG - Intergenic
1192313824 X:70036818-70036840 CTGGCCTTTCAGATAAGGCCTGG - Exonic
1195068117 X:101255543-101255565 CTGCAACTTCAGATGAGGGAGGG - Intronic
1195143397 X:101987117-101987139 CTGGAGGATCACATGAGGCCAGG + Intergenic
1196369288 X:114957688-114957710 CTGGAGTTTGAGATCAGCGTGGG + Intergenic
1197140651 X:123114215-123114237 CTGGATTTGAAGATGAGGGAAGG - Intergenic
1198122842 X:133611046-133611068 CAGGAGAATCAGTTGAGGGCAGG + Intronic
1198845904 X:140910187-140910209 CTGGAGATTCAGATGAGAGTTGG - Intergenic
1199319606 X:146422856-146422878 CTGGAGGTTCAGGAGAGGGAAGG - Intergenic
1201047676 Y:9903993-9904015 CAGGAGTTCCAGATGAGCCCGGG + Intergenic
1201349669 Y:13025849-13025871 CTGGAGTTCCAGAGGAAGGAAGG - Intergenic