ID: 966811986

View in Genome Browser
Species Human (GRCh38)
Location 3:183855135-183855157
Sequence CTGAGGGGAAGGAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3539
Summary {0: 1, 1: 3, 2: 25, 3: 359, 4: 3151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966811972_966811986 25 Left 966811972 3:183855087-183855109 CCAGAAGAGGAAAGTCCCTAGAG 0: 1
1: 0
2: 2
3: 89
4: 724
Right 966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG 0: 1
1: 3
2: 25
3: 359
4: 3151
966811974_966811986 10 Left 966811974 3:183855102-183855124 CCCTAGAGAAAGCAGGTTGATGG 0: 1
1: 0
2: 3
3: 13
4: 197
Right 966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG 0: 1
1: 3
2: 25
3: 359
4: 3151
966811976_966811986 9 Left 966811976 3:183855103-183855125 CCTAGAGAAAGCAGGTTGATGGC 0: 1
1: 0
2: 0
3: 16
4: 153
Right 966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG 0: 1
1: 3
2: 25
3: 359
4: 3151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966811986 Original CRISPR CTGAGGGGAAGGAGGGAAGG AGG Intronic
Too many off-targets to display for this crispr