ID: 966812317

View in Genome Browser
Species Human (GRCh38)
Location 3:183858003-183858025
Sequence CTCATTTCTCAGATGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 6, 3: 32, 4: 307}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966812317 Original CRISPR CTCATTTCTCAGATGGGGCA AGG (reversed) Intronic
900290101 1:1920146-1920168 CACATTCCCCAGGTGGGGCATGG - Intergenic
900638449 1:3676737-3676759 CTCATCTCTGAACTGGGGCAGGG + Intronic
900867204 1:5277029-5277051 CCCATTTCACAGACCGGGCATGG + Intergenic
902398426 1:16144695-16144717 CTCATTTTACAGATGGGGGTGGG + Intronic
902407458 1:16192459-16192481 CCCATTTTGCAGATGGGGCTTGG + Intergenic
902785813 1:18731902-18731924 GTCCTTTCTCAGAAGGGGCTTGG - Intronic
903051464 1:20604360-20604382 CTCATGCGGCAGATGGGGCAAGG + Intronic
904052281 1:27646917-27646939 CTCATTGCGCAGCTGGGGCGTGG - Intergenic
904415673 1:30359854-30359876 TTCATCTGTCAAATGGGGCAAGG - Intergenic
904455942 1:30648105-30648127 CCCATTTCCCAGATGGAGAACGG + Intergenic
904594975 1:31638256-31638278 CCCATTTTACAGATGGGGGAGGG + Intronic
904809070 1:33151530-33151552 CTGACTTCTCAGAGGGGGAAGGG - Intronic
907579241 1:55556981-55557003 CTCATTTCTCAGTGTGGGAAGGG - Intergenic
908439348 1:64137962-64137984 CTCATTTCACAGATGAAGAAGGG - Intronic
909623105 1:77687542-77687564 CTCACTTCCCAGATGGGGTGGGG - Intergenic
910891746 1:92026465-92026487 CTCACTTCCCAGATGGGGTGGGG + Intergenic
911283921 1:95966345-95966367 CTCACTTCCCAGATGGTGCGGGG + Intergenic
914450248 1:147785310-147785332 CTCAGCTCTCAGAGGGGTCAGGG - Intergenic
914947222 1:152078581-152078603 CTCACTTCCCAGACGGTGCAGGG + Intergenic
914947377 1:152079265-152079287 CTCACTGCCCAGATGGGGCAGGG + Intergenic
915075402 1:153304437-153304459 CTCATTTGACAGCTGGGGCTAGG - Intronic
915386067 1:155493575-155493597 TTCATTTTTCAGGGGGGGCATGG + Intronic
915863384 1:159471771-159471793 CTCAGTTGGCAGAAGGGGCAAGG - Intergenic
915866719 1:159508866-159508888 CTGAGTTCTTAGATGGGGCTCGG + Intergenic
916802469 1:168227282-168227304 CTCATTTCACAGATGGGGAACGG - Intronic
917256515 1:173121994-173122016 CCCATTTCAGAGATGGGGCGTGG + Intergenic
917454508 1:175174477-175174499 CTCATTTCTCAGATGAGGAAAGG - Intronic
918489252 1:185062910-185062932 CCCACTTATCAGATTGGGCAGGG + Intronic
919814084 1:201426750-201426772 CTGAGTTCTGAGAGGGGGCAGGG + Intronic
920154260 1:203935592-203935614 CTCATTTCTCAGATCTGCAAGGG - Intergenic
920689335 1:208134041-208134063 CTCATTTCTCTAAATGGGCAAGG - Intronic
920866485 1:209757885-209757907 CTCATTTATAAAATGGGGCTAGG - Intronic
920977892 1:210803055-210803077 CTCATTTCACAGATCTGGGATGG + Intronic
921007729 1:211111549-211111571 CTCACTTCCCAGACGGGGCGGGG - Intronic
921007751 1:211111628-211111650 CTCACTTCCCAGACGGGGCGGGG - Intronic
923520777 1:234733428-234733450 CTCATGTGTCAAATGTGGCAAGG + Intergenic
923930724 1:238692936-238692958 ATGTTTTCCCAGATGGGGCAAGG + Intergenic
1063856939 10:10265439-10265461 CTCATGTGTTGGATGGGGCAGGG - Intergenic
1065188039 10:23188181-23188203 TGCATTTCTGAGATGGGGGAGGG + Intergenic
1066025992 10:31361583-31361605 CTCACTTCCCAGACGGTGCAGGG + Intronic
1066026221 10:31362507-31362529 CTCACTGCCCAGACGGGGCAGGG + Intronic
1066366449 10:34781452-34781474 CTCCTTTCACAGATGAGGCTTGG + Intronic
1066474143 10:35728242-35728264 CACATTTCTGACATGGGGAATGG + Intergenic
1067136216 10:43609278-43609300 CTAATTACTCAGTTGGAGCAAGG + Exonic
1067189659 10:44058790-44058812 TTCAGATCTCAGATGGGGAAGGG + Intergenic
1067343551 10:45422380-45422402 CCCACTTCTCAGGTGGAGCATGG - Intronic
1067451903 10:46386883-46386905 CTCACTTCCCAGATGAGTCAGGG + Intronic
1067585335 10:47472872-47472894 CTCACTTCCCAGATGAGTCAGGG - Intronic
1068660968 10:59622958-59622980 CTCACTTGTCAGATGAGGAACGG + Intergenic
1069332003 10:67303804-67303826 CTCACTTAGCAGATGCGGCATGG - Intronic
1069434020 10:68364011-68364033 CTCATTTCTAAGATGAGATAAGG + Exonic
1069562765 10:69442259-69442281 CTCATTACTCAGAAGGGCCTGGG - Intergenic
1069832927 10:71291918-71291940 CCCATCTCACAGATGGGGAAAGG + Intronic
1070658574 10:78288713-78288735 CCCATTTTACAGATGGGGAAGGG - Intergenic
1070789924 10:79182920-79182942 CTCACTGCTCAGATGGTGAAGGG - Intronic
1071071149 10:81696025-81696047 CTGATTTCTCACATGGTGAAAGG + Intergenic
1071262866 10:83936763-83936785 CTCATTACACAGATGAGGGAAGG + Intergenic
1071341770 10:84655633-84655655 CTCACTTCCCAGACAGGGCAGGG + Intergenic
1071586132 10:86823369-86823391 CTCATTTTACAGATTGGGTACGG + Intronic
1074072288 10:110084614-110084636 CTCATTTCTCATATGGAGAAAGG - Intronic
1074592115 10:114822432-114822454 CTCATTCCTCTGATGGGGCCGGG + Intronic
1074718794 10:116247131-116247153 CCATTTTCTGAGATGGGGCAGGG - Intronic
1074889928 10:117727156-117727178 CTCATCTATAAAATGGGGCAGGG + Intergenic
1075551271 10:123394500-123394522 CTCGTTCCCCAGATGAGGCAGGG - Intergenic
1076445020 10:130508579-130508601 CTCAATTCTCACGTGGGGGAAGG - Intergenic
1077680751 11:4237896-4237918 CTTACTTCTCAGATGGGGCGGGG - Intergenic
1079067447 11:17308193-17308215 CTCATTCCAGAGCTGGGGCAAGG - Intronic
1082065083 11:47893016-47893038 CTCACTTCTCAGACGGGGGGGGG - Intergenic
1083011337 11:59402963-59402985 CTTATTTCTCAGTGGGGGTAGGG - Intergenic
1085641532 11:78196094-78196116 CTCATCTGTGAAATGGGGCAAGG - Intronic
1085730163 11:78991049-78991071 GTGATTTCTCAGATGGCGCATGG + Intronic
1085906626 11:80772184-80772206 CTCATTGCTGAGATGAGGAAAGG - Intergenic
1085976499 11:81661465-81661487 CACAATGCACAGATGGGGCATGG - Intergenic
1086522428 11:87684993-87685015 CTCATTTCTCCAAGGGGCCATGG + Intergenic
1087427407 11:98007786-98007808 ATTATTTCCCAGAGGGGGCAGGG - Intergenic
1089523977 11:119084774-119084796 CTCATGTCACAGCTGGGGAATGG + Intergenic
1090253156 11:125264862-125264884 CCCATTTCACAGATGGGGCCAGG - Intronic
1090277610 11:125430959-125430981 CTGCTTCCTGAGATGGGGCAGGG + Intronic
1090550435 11:127813780-127813802 CTCACTGCTCCCATGGGGCAGGG - Intergenic
1090998951 11:131892213-131892235 CTCATCTGTCAAATGGGACATGG + Intronic
1091949310 12:4580016-4580038 CTCATTTTACAGATGGAGAAAGG - Intronic
1093480844 12:19602383-19602405 CTCATATGGCAGAGGGGGCATGG - Intronic
1093658450 12:21724772-21724794 CTGATTTCTCTGATGGAGCTGGG + Intronic
1093779577 12:23120244-23120266 CTCATTTCTCACAGTGGCCATGG - Intergenic
1094115304 12:26904751-26904773 CTCATTTCTCAGAGATGTCATGG - Intergenic
1094269076 12:28591054-28591076 CTCAGTTCTCAGTAGGGCCAAGG + Intergenic
1095373716 12:41501194-41501216 CTTATTTCTCATAAGAGGCATGG + Intronic
1096427548 12:51516936-51516958 CTCATCTCTAAGATGGGAAAAGG + Intergenic
1096536079 12:52275691-52275713 CCCATTTCACAGATGGAGAAAGG + Intronic
1096603168 12:52745013-52745035 CTCATTTCTCAGACAGGGATTGG - Intergenic
1098233515 12:68396611-68396633 CTCAGTTCTCAGGCCGGGCACGG + Intergenic
1100392281 12:94154181-94154203 CTCATTCACCATATGGGGCAAGG + Intronic
1101164094 12:102010235-102010257 CCCAGTTCCCAGATGGGGTAGGG + Intronic
1101652907 12:106693976-106693998 CCCATTTCACAGAAGGGGAACGG + Intronic
1103198834 12:119069740-119069762 CTTATTTCTTAGATGGTGCCTGG + Intronic
1103242023 12:119421637-119421659 CCCATTTCACAGATGGGGATTGG + Intronic
1105044847 12:132993979-132994001 CCCATCTCTTAGATGGGACAGGG + Intronic
1106107666 13:26747846-26747868 CGCATTTTTGAGAAGGGGCAGGG - Intergenic
1106419844 13:29577151-29577173 CTCAATGGTCGGATGGGGCAGGG + Intronic
1106881448 13:34136135-34136157 CTCATTTGTCAGCTGGGTCATGG + Intergenic
1107318448 13:39159741-39159763 CTCATTTCTCTGGAGGGACAGGG + Intergenic
1108666285 13:52634831-52634853 CTCATTTTACAGTTGGGGAAAGG - Intergenic
1109316697 13:60757611-60757633 CACATTTCTCAGACGGGCCTGGG - Intergenic
1110626571 13:77661084-77661106 CTCACTGCCCAGACGGGGCAGGG + Intergenic
1111189824 13:84792426-84792448 CTCATCTCTCAGTTGGGGGGTGG - Intergenic
1112224639 13:97526581-97526603 CTCATTTCTCAGTTGCAGCTTGG + Intergenic
1112854592 13:103751558-103751580 CTTATCTCTGAAATGGGGCAAGG + Intergenic
1113156251 13:107326278-107326300 CTCATTTATCAGAAGGAGAATGG - Intronic
1115530233 14:34320323-34320345 CTCATTTCCAAAATAGGGCATGG - Intronic
1117258015 14:54000047-54000069 CTAATTTCTTCCATGGGGCAGGG + Intergenic
1117287814 14:54304263-54304285 CTCATATGGCAGAAGGGGCAAGG - Intergenic
1118347190 14:64948857-64948879 ATAATTTCTCAGATGGGACTGGG + Intronic
1119178647 14:72588573-72588595 CTCATTACTCAGAAGGGGGAAGG - Intergenic
1119602079 14:75982922-75982944 CCCATTTCCCAGATGGGTGAGGG + Intronic
1119716036 14:76860134-76860156 TTCATTCCTCAGATGTGGCTCGG - Intronic
1121085945 14:91146171-91146193 CTCATTTTTAAAATGGGGCATGG - Intronic
1121379917 14:93455962-93455984 CTCATTGTTGAGATGAGGCAAGG + Intronic
1121893411 14:97621031-97621053 CTTCTGACTCAGATGGGGCAAGG + Intergenic
1122105243 14:99448197-99448219 CTCATTTTTCAAATGGGGAATGG - Intronic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1124583559 15:30984645-30984667 TTCATTTCCCAGATGGCCCATGG + Intronic
1124701604 15:31918196-31918218 CTCAGTTCTCTGATGGGTTAAGG + Intergenic
1126161906 15:45621387-45621409 TTCATTTACAAGATGGGGCAAGG + Intronic
1127688931 15:61375867-61375889 ATCATCTCCCAGAGGGGGCATGG - Intergenic
1128723894 15:69973775-69973797 CTGATTTCACAGATGGGGGCAGG - Intergenic
1129236748 15:74228318-74228340 CTCATTTTACAGATGAGGAAAGG - Intergenic
1132024259 15:98391599-98391621 CTCATCTGCCAGATGGGGCAAGG + Intergenic
1132828424 16:1916329-1916351 CTCATTTTTTAGAAGGGGGAGGG - Intronic
1133597071 16:7303640-7303662 CTCATTTGTCAAATGGGTCCAGG - Intronic
1134750089 16:16618949-16618971 CTCACTTCCCAGACGGGGCGGGG + Intergenic
1134776408 16:16857417-16857439 CTTGTTTTTCAGATGAGGCAGGG + Intergenic
1135139491 16:19909312-19909334 CTCACTTCTCAGGGTGGGCAAGG + Intergenic
1135940816 16:26820117-26820139 CTCCTTTTACAGATGGGGAAAGG - Intergenic
1136536787 16:30904233-30904255 CTCATCTAGCAGATGGGGCTTGG - Intergenic
1138317173 16:56080383-56080405 CTCATTTGGCAGAAGGGGCAAGG + Intergenic
1138753098 16:59447864-59447886 CTCATGTGGCAAATGGGGCAAGG + Intergenic
1138829147 16:60357842-60357864 CTCACTTCCCAGACGGTGCAGGG + Intergenic
1141172471 16:81700160-81700182 CTCATCAGTCAGATGGGGCCAGG + Intronic
1141522521 16:84590483-84590505 CCCATTTCACAGATGGGAAATGG + Intronic
1141533255 16:84661305-84661327 CCCATTTCCCAGATGGGGCAAGG + Intronic
1141552760 16:84817196-84817218 TTCATTTCACAGATGGGGCATGG + Intergenic
1141769126 16:86078256-86078278 CTCATTGCTCAGTTTGAGCATGG - Intergenic
1142421832 16:89975631-89975653 CTACTTTCTCAGATGGGCAATGG + Intergenic
1142638935 17:1274080-1274102 CTCATCTCTCTGATGCCGCAGGG + Intergenic
1142799812 17:2337892-2337914 CCCCTTTCTCGGATGGGGGAGGG + Intronic
1143121800 17:4612551-4612573 CTGATTCCACAGTTGGGGCAAGG - Intergenic
1144162371 17:12572374-12572396 CTCATCTGTGAGATGGGGCTGGG - Intergenic
1146032146 17:29375446-29375468 CTCATTTTACAGATGGGGAAAGG + Intergenic
1146086163 17:29831985-29832007 CTCATTTTTCAAATTTGGCAAGG + Intronic
1146923604 17:36729543-36729565 CCCATTTCACAGATGGGAAAGGG - Intergenic
1147263403 17:39221799-39221821 CTCACCTCTCAGCTGGGCCAGGG + Intronic
1147899106 17:43772332-43772354 CTCATTCCTAGGGTGGGGCAGGG - Intronic
1148219176 17:45850080-45850102 CCCATTTCACAGATGGGGCTGGG + Intergenic
1148598485 17:48876082-48876104 TCCATTTCACAGATGGGTCACGG + Intergenic
1149489611 17:57074113-57074135 CTCAGTTCACAGATGAGACAAGG + Intergenic
1150337800 17:64343097-64343119 CTCCTTTTACAGATGGGGAAAGG + Intronic
1151088022 17:71403543-71403565 CTGATTTCTAAGATGAGTCAAGG - Intergenic
1151486467 17:74404149-74404171 CTATTTTCTCAGATGTGGGAGGG - Intergenic
1152682076 17:81673677-81673699 CTCAGTTCCCAGATGGTGCTGGG - Exonic
1152938884 17:83155299-83155321 CTCAGGTCTGAGCTGGGGCAGGG - Intergenic
1153782215 18:8504727-8504749 CTCCTTTCTCAGTTGGGGTTTGG - Intergenic
1157519333 18:48334592-48334614 CTCATTCTTCAGATGGGGCTGGG + Intronic
1160947623 19:1651112-1651134 CTCCATTCTAAGATGGGGGATGG + Intronic
1161061077 19:2215252-2215274 TTTATTTTTCAGATGGGGCCTGG - Intronic
1161629015 19:5342191-5342213 CTCATCTGTAAAATGGGGCAAGG + Intergenic
1163154354 19:15432115-15432137 CGCGTCTGTCAGATGGGGCAGGG + Intronic
1165226243 19:34357314-34357336 CCCATTTCTCAGATGGGCCAAGG - Intergenic
1165636879 19:37347800-37347822 CTCATTGCTCAGCTGGAGCGAGG + Exonic
1166159638 19:40942195-40942217 CTCATGTCGCAGGTGGGCCAGGG + Intergenic
925568450 2:5282951-5282973 CTCTGGCCTCAGATGGGGCATGG + Intergenic
927369856 2:22341908-22341930 CTTATTTCTGAAATGGGCCATGG + Intergenic
928449587 2:31366643-31366665 CTCATTTATAAAATGGGGCCTGG - Intronic
928816758 2:35305667-35305689 CACATTTCTCCGATGGCCCAGGG + Intergenic
929018279 2:37524193-37524215 CTCATTTTTCAAATGGAGGAGGG + Intergenic
929873819 2:45779527-45779549 CTCAGTTCACAAATGGAGCAAGG - Intronic
931047176 2:58367780-58367802 CTCATTTCTAAGATATGACAAGG + Intergenic
931094150 2:58920560-58920582 TTCATTCCTCAGCTTGGGCAAGG - Intergenic
931243897 2:60477050-60477072 TTCATTTCTCGAGTGGGGCAGGG - Intronic
932062934 2:68527078-68527100 CTCACTTCCCAGACGGTGCAGGG + Intronic
932063133 2:68527922-68527944 CTCACTGCCCAGACGGGGCAGGG + Intronic
935011224 2:99137952-99137974 CTCATATGTTAGAAGGGGCAAGG - Intronic
936143865 2:109965856-109965878 CTCACTTGACAGAAGGGGCAAGG - Intergenic
936180547 2:110263818-110263840 CTCACTTGACAGAAGGGGCAAGG - Intergenic
936200822 2:110405613-110405635 CTCACTTGACAGAAGGGGCAAGG + Intronic
937162764 2:119781194-119781216 CTGATTTCAGAGCTGGGGCAAGG - Intronic
937249945 2:120517279-120517301 CCCATTTCACAGATGGGGGAAGG + Intergenic
937430448 2:121833487-121833509 TTCATTGCACAGATGAGGCACGG + Intergenic
937845153 2:126571541-126571563 CTCATTTTACAGATGAAGCACGG + Intergenic
940652428 2:156451836-156451858 CTCACTTCTCAGATGGGCGGAGG + Intronic
940842591 2:158601166-158601188 CTAATTGCTCAAATGGGGCAAGG - Intronic
940966849 2:159847569-159847591 CACTTTTCTAAGGTGGGGCAGGG + Intronic
941255540 2:163226679-163226701 ATCATTTCTCAGGCTGGGCACGG + Intergenic
941382601 2:164814207-164814229 CCGATTTATCAGATGGGGAAGGG - Intronic
941575654 2:167226877-167226899 CTCCTTGTTCAGCTGGGGCATGG + Intronic
943028679 2:182660168-182660190 CTCATTTCTTAGATAAGGCTGGG - Intergenic
943417422 2:187625859-187625881 CTCATTTTTCAGATAGGAAATGG + Intergenic
944021329 2:195108027-195108049 CTCATTTTCTAGATGGGGCATGG - Intergenic
944118947 2:196219844-196219866 CTCATCTGTCAGATGGGAGAAGG - Intronic
944283964 2:197926859-197926881 TTCATTTGACAGCTGGGGCAGGG + Intronic
946011919 2:216572231-216572253 CTAAATTCTGAAATGGGGCAAGG - Intronic
946253081 2:218425388-218425410 GTTATTTCTGAGATGAGGCAAGG + Intronic
946631468 2:221673954-221673976 CCAATGTCTCACATGGGGCAGGG - Intergenic
1169348242 20:4846939-4846961 CCCATTGCTCACATGGAGCAAGG + Intergenic
1169694840 20:8375754-8375776 CTCATCTATGAAATGGGGCATGG + Intronic
1170153501 20:13249273-13249295 CCCATTTCACAGATGGAACAGGG + Intronic
1170561567 20:17563085-17563107 CTCATCCCACAGATGGGGTAAGG - Intronic
1172002169 20:31787793-31787815 CGCATTTCTCAGGTGAGCCAAGG + Intronic
1172882133 20:38208960-38208982 TCCATTTCACAGATGGGGAAAGG + Intergenic
1173176290 20:40767315-40767337 CTGATCTCTCACATGGGCCAGGG + Intergenic
1173485892 20:43440812-43440834 CTCATTTCTCATCTGTAGCATGG - Intergenic
1173984682 20:47251833-47251855 CTCACTTCCCAGATGGTGCGGGG - Intronic
1174068561 20:47883527-47883549 GTCATTTCTGAGATGGTGGAAGG + Intergenic
1174186025 20:48706916-48706938 CTCCTTTCCCACCTGGGGCAGGG - Intronic
1174222683 20:48969837-48969859 CCCATTTTTCAGATGAGGCTTGG - Intronic
1175881214 20:62260352-62260374 GGCATTTCTTAGATGGGGAAAGG - Intronic
1177788296 21:25695653-25695675 CTCACTTCCCAGACGGGGCGGGG + Intronic
1179034652 21:37749129-37749151 CTAACTTCTGAGCTGGGGCATGG + Intronic
1181869256 22:25885236-25885258 CCCATCTCACAGATGAGGCAAGG + Intronic
1182168814 22:28205715-28205737 ATGATTTCTCAGATAGGGGAAGG + Intronic
1182667020 22:31967456-31967478 CTCATCTATAAGATGGGCCATGG - Intergenic
1184301609 22:43564046-43564068 CCCATTTCTCAGATGGAGGACGG - Intronic
1184388308 22:44188637-44188659 CCCATTTCACAGATGAGGAAAGG + Intronic
1184593131 22:45499140-45499162 CTCATCTGTCACGTGGGGCAAGG - Intergenic
1184697078 22:46145775-46145797 CTCATCTCTAAAATGGGGCAGGG - Intergenic
1185114193 22:48922056-48922078 CTTAATTCTCAGACGGTGCAAGG - Intergenic
949975455 3:9454143-9454165 CATATTTATAAGATGGGGCAAGG + Intronic
950726472 3:14920364-14920386 ATCATTTATTAGGTGGGGCATGG + Intronic
952101045 3:30013346-30013368 CCCATTTCCCAGATGGGGCTTGG + Intergenic
952616010 3:35274967-35274989 CTCATTTCTCATATTTTGCATGG + Intergenic
953415188 3:42711727-42711749 CTCATTTTACGGATGGGCCAGGG + Intronic
953450106 3:42998566-42998588 CTCATTTCTAAAATGGTGGAAGG - Intronic
954519693 3:51213695-51213717 CTCATTTCTCATATTTGGGATGG + Intronic
956668214 3:71661798-71661820 CTCATTTGTCAAATGGTGGATGG + Intergenic
956733762 3:72219958-72219980 CTCATCTGTAAAATGGGGCAGGG + Intergenic
958816457 3:98921688-98921710 CTTATTTCACAGATGAGGAATGG + Intergenic
962348851 3:134642270-134642292 CTCCTGTTTCATATGGGGCATGG + Intronic
962828607 3:139120670-139120692 GTCATTTCCGAGATGGGGGAAGG + Intronic
963719841 3:148849792-148849814 CTCATTTTCCAGCTGAGGCATGG + Intronic
966812317 3:183858003-183858025 CTCATTTCTCAGATGGGGCAAGG - Intronic
967604178 3:191424720-191424742 CTCATTAATCAGATGGGACCAGG + Intergenic
970468696 4:16353474-16353496 GTCATTGCTGAGATGAGGCATGG - Intergenic
971236787 4:24849533-24849555 CTTAGCTCTCACATGGGGCAGGG - Intronic
972646865 4:40976746-40976768 CTATTTATTCAGATGGGGCAAGG + Intronic
973650934 4:52996542-52996564 TTTATTTCTCAGAAGGGGAAGGG - Intronic
974206767 4:58713968-58713990 CTTATTTCTCAGATAGGACTTGG - Intergenic
974492539 4:62585658-62585680 CTCATGTTGCAGAAGGGGCAAGG - Intergenic
980682771 4:136186276-136186298 CTCAAAACTAAGATGGGGCAGGG + Intergenic
982479286 4:155889602-155889624 CTCACTTCACAGATGGGAAACGG - Intronic
986245473 5:6002948-6002970 CTCAGTTCTCAAATGGTGAACGG - Intergenic
988155229 5:27441293-27441315 CTCATTTCCCAAATAGGACATGG + Intergenic
989281365 5:39647721-39647743 GTCATTTGTCAAATGGGGCAAGG - Intergenic
990519892 5:56569044-56569066 TTCATTTATCAGATGGGCAAAGG + Intronic
990832753 5:59978217-59978239 CTTATTTCTCTGATGGATCAGGG + Intronic
992917588 5:81474144-81474166 CTCATCTTTCAGATGGGCTAAGG + Intronic
993585744 5:89725493-89725515 CATATTTCTCAGTTGAGGCAGGG - Intergenic
994286852 5:97979693-97979715 CCCATTTCTTGGAGGGGGCAGGG + Intergenic
994915359 5:105969475-105969497 CTCACTTCTCTGATGGATCATGG + Intergenic
995783125 5:115798842-115798864 CTCATTGCTGAAATGGAGCAGGG + Intergenic
997232041 5:132252523-132252545 CTCATCTGTCAGCTGGGGCCTGG - Intronic
998933354 5:147206007-147206029 CTCATTTGTCAGATGAGGTTTGG - Intergenic
999198660 5:149800668-149800690 GTCATGTGACAGATGGGGCAGGG + Intronic
1000157993 5:158570736-158570758 CTCATATCTCAGATGTGTGATGG + Intergenic
1001070428 5:168580270-168580292 CTCATTTTGAAGATGGGGCACGG + Intergenic
1001081507 5:168671121-168671143 CCTATTTCTCAGGTGGGGTAGGG + Intronic
1004426053 6:15507895-15507917 CTCATTTCTGAGCTGAGCCAAGG + Intronic
1005243407 6:23855730-23855752 CTCACTGCCCAGACGGGGCAGGG - Intergenic
1005243518 6:23856214-23856236 CTCACTTCCCAGATGGTGCAGGG - Intergenic
1006107850 6:31727495-31727517 CTCTTTTCTCTGATGGTGCTTGG + Intronic
1006798154 6:36743878-36743900 CTCATCTCTAACACGGGGCATGG - Intronic
1007097972 6:39226034-39226056 CTCATTTTGCAGATGAGGAAAGG + Intronic
1007418367 6:41705281-41705303 CTCATTGTTCAGATGGAGCTGGG - Intronic
1009398278 6:63228071-63228093 CTCACTTCCCAGATGGTGCGGGG + Intergenic
1009398417 6:63228715-63228737 CTCACTGCCCAGATGGGGCAGGG + Intergenic
1009414211 6:63397244-63397266 TTGATTTCTTAGATGGTGCATGG - Intergenic
1011297199 6:85838557-85838579 CTCACATCCCAGATGGGGCGGGG - Intergenic
1013099085 6:106973393-106973415 CTCAATTCTTTGATGGGGGAGGG - Intronic
1013381194 6:109572904-109572926 CTCATTTGGTGGATGGGGCAAGG - Intronic
1013922699 6:115427789-115427811 CTGATTTCTCTGATGGGTCTGGG - Intergenic
1014286363 6:119503442-119503464 CTCAATTCCCACATGGGGAAAGG - Intergenic
1015061485 6:128971961-128971983 CCCATCTCTCAGCTGAGGCAAGG - Intronic
1015377557 6:132527889-132527911 GTCATCTCTCAGTGGGGGCAGGG - Intergenic
1015799556 6:137046466-137046488 CCCTTTTTTCAGATGAGGCAAGG + Intergenic
1017521894 6:155209785-155209807 CTCACTTCTAAGATAGGGGAAGG - Intronic
1018530324 6:164756218-164756240 CTCATCACTCAGCTGGTGCAGGG - Intergenic
1018568596 6:165183892-165183914 GTCCTCTCTCACATGGGGCAGGG - Intergenic
1019194973 6:170275898-170275920 CTCATTTATAAGGTGGGGCCAGG - Intergenic
1021493505 7:21246609-21246631 CTCACTTCCCAGATGGGGTGGGG + Intergenic
1023153065 7:37220805-37220827 CTTCTTTCACAGATGGGGAAAGG + Intronic
1024548960 7:50544490-50544512 TTCATTTCTCAGATGAGGAGAGG - Intronic
1025035711 7:55591485-55591507 CTCATTGCTCTGAAGTGGCAGGG - Intergenic
1026523464 7:71135332-71135354 CTCATTTCTCAACTGGGGATGGG - Intronic
1028509739 7:91610677-91610699 CTTATTTCCCAGCTTGGGCAGGG - Intergenic
1028745531 7:94322026-94322048 CTCAATTCTGAGATAGGGAATGG - Intergenic
1029029698 7:97454587-97454609 CTCATATCACAGAAGGGGCAAGG - Intergenic
1030206300 7:106955368-106955390 CTCATATGACAGAAGGGGCAAGG - Intergenic
1032545484 7:132738221-132738243 CTGACATCTCAGATGGGGCCTGG + Intergenic
1032892483 7:136213235-136213257 CTCACTTCCCAGATGGTGCGGGG + Intergenic
1032896030 7:136251742-136251764 CCCTTTTCTCAGGTGGGGAATGG + Intergenic
1034221647 7:149451067-149451089 CTCATGTCACAGATGGAGCGCGG - Exonic
1034676729 7:152897544-152897566 CACATTTCTCAGATCGCGAAGGG - Intergenic
1035360428 7:158309959-158309981 CTCATGTGGCAGACGGGGCAAGG - Intronic
1036494294 8:9255550-9255572 CTCATTGCTGACAAGGGGCACGG - Intergenic
1038944110 8:32337841-32337863 CTCATTTCTGAGATGATGAATGG - Intronic
1039311249 8:36320836-36320858 CTCACTTCCCAGATGGTGCTGGG + Intergenic
1039729749 8:40261703-40261725 CTCATTTCTCAGCAAGGACAAGG - Intergenic
1039791354 8:40878299-40878321 ATCATCTGTGAGATGGGGCAAGG - Intronic
1040642588 8:49356308-49356330 CTCATTTCTAAAAGGGGTCAAGG + Intergenic
1040673242 8:49717616-49717638 CTCACATGGCAGATGGGGCAAGG - Intergenic
1046502229 8:115093506-115093528 CTCACCACTTAGATGGGGCAGGG + Intergenic
1046671849 8:117064786-117064808 CTCCTCTCCCAGATGGGGCTGGG - Intronic
1049001311 8:139827104-139827126 CCCATTTCTAAAATGGGGAAGGG + Intronic
1049043065 8:140126943-140126965 ATCCTTTCCCAGATGGGGCTGGG + Intronic
1049398345 8:142412339-142412361 CTCATTTTCCAGATGGGAAAAGG - Intergenic
1051869461 9:21720141-21720163 CTCATTTCACAAATGAGGCAAGG - Intergenic
1052413542 9:28149546-28149568 CTCACTGCCCAGACGGGGCAGGG - Intronic
1052413686 9:28150189-28150211 CTCATTTCCCAGACGGTGCAGGG - Intronic
1052735254 9:32335236-32335258 CTCATTTGTCAGAATAGGCATGG - Intergenic
1056019936 9:82430953-82430975 CTCACTTCTCAGACAGTGCAGGG + Intergenic
1056576262 9:87857941-87857963 CTCACTTCCCAGATGGTGCAGGG + Intergenic
1056932515 9:90890657-90890679 GTGATTTCTAATATGGGGCATGG - Intronic
1057004637 9:91546594-91546616 CTCAGTTCTCTGATGGGCCCCGG - Intergenic
1057071907 9:92106080-92106102 CTCACTTCCCAGACGGTGCAGGG - Intronic
1057719691 9:97522015-97522037 ATCATTTCACAGATGAGCCACGG + Intronic
1057899198 9:98934801-98934823 CTCATTTGTCAGATGTTGGATGG + Intergenic
1059284027 9:113157497-113157519 CTCTATTCTCATATGGAGCATGG + Intronic
1059426031 9:114221573-114221595 GTCATTTCTCATGTGGGCCATGG + Intronic
1060370000 9:123059709-123059731 CTGTGTTCTCATATGGGGCAGGG - Intronic
1060588312 9:124800432-124800454 CCCATTTGGCAGATGAGGCATGG + Intronic
1061016402 9:127983228-127983250 CTCATTTCCCTGATGGTGCCTGG + Intergenic
1061204775 9:129156580-129156602 CTCATTTCACAGAAGGGTCTGGG + Intergenic
1061403634 9:130382058-130382080 CTCATTTCACAGATGAGGCAGGG + Intronic
1061806720 9:133141046-133141068 CCCATTTGACAGATGGGGCAAGG + Intronic
1061902150 9:133678426-133678448 CTCTTTCCCCAGATGGGTCATGG + Intronic
1062597562 9:137306091-137306113 GTCATTTCACAGATGGGGAGGGG - Intergenic
1188098771 X:26056268-26056290 ATCATTTCTCATATGGGACCAGG - Intergenic
1188746445 X:33850640-33850662 CTCACATGTCAGAAGGGGCAAGG + Intergenic
1190106940 X:47567580-47567602 CTCATTTCCCAGAGGGGAAAGGG - Intronic
1192212674 X:69137599-69137621 ATCAGTTCTCAAATGGGGCTGGG + Intergenic
1192236906 X:69301875-69301897 CTCATTTCACAAATGGTTCAAGG - Intergenic
1192786792 X:74344080-74344102 GTCATTACTCAGAAGGGGAAAGG - Intergenic
1193223889 X:78959074-78959096 GTTGTTTCTCAGATGGGGAAGGG - Intronic
1195305130 X:103574417-103574439 CACATCTCTCAGATGGACCACGG - Intergenic
1198055180 X:132987142-132987164 CACATTTTACAGATGGGGAAAGG - Intergenic
1199074313 X:143511755-143511777 TTGATATCACAGATGGGGCAAGG - Intronic
1199570431 X:149262058-149262080 CACATTTCTCTGAAGGGGCAGGG - Intergenic
1200326003 X:155240024-155240046 CTCATGTGGCAGAAGGGGCAAGG + Intergenic