ID: 966818835

View in Genome Browser
Species Human (GRCh38)
Location 3:183909379-183909401
Sequence GGTGGGCCCGATCCCCGTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 35}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966818835_966818842 17 Left 966818835 3:183909379-183909401 CCGCAACGGGGATCGGGCCCACC 0: 1
1: 0
2: 0
3: 0
4: 35
Right 966818842 3:183909419-183909441 CTGCGCCAGCTGTGGAGAGATGG 0: 1
1: 0
2: 0
3: 14
4: 328
966818835_966818841 9 Left 966818835 3:183909379-183909401 CCGCAACGGGGATCGGGCCCACC 0: 1
1: 0
2: 0
3: 0
4: 35
Right 966818841 3:183909411-183909433 AACACACTCTGCGCCAGCTGTGG 0: 1
1: 0
2: 1
3: 7
4: 176
966818835_966818844 19 Left 966818835 3:183909379-183909401 CCGCAACGGGGATCGGGCCCACC 0: 1
1: 0
2: 0
3: 0
4: 35
Right 966818844 3:183909421-183909443 GCGCCAGCTGTGGAGAGATGGGG 0: 1
1: 0
2: 4
3: 20
4: 254
966818835_966818845 20 Left 966818835 3:183909379-183909401 CCGCAACGGGGATCGGGCCCACC 0: 1
1: 0
2: 0
3: 0
4: 35
Right 966818845 3:183909422-183909444 CGCCAGCTGTGGAGAGATGGGGG 0: 1
1: 0
2: 1
3: 20
4: 221
966818835_966818843 18 Left 966818835 3:183909379-183909401 CCGCAACGGGGATCGGGCCCACC 0: 1
1: 0
2: 0
3: 0
4: 35
Right 966818843 3:183909420-183909442 TGCGCCAGCTGTGGAGAGATGGG 0: 1
1: 0
2: 1
3: 10
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966818835 Original CRISPR GGTGGGCCCGATCCCCGTTG CGG (reversed) Intergenic