ID: 966819157

View in Genome Browser
Species Human (GRCh38)
Location 3:183911244-183911266
Sequence GGCTGTGAGGAGCCTCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966819157_966819162 -9 Left 966819157 3:183911244-183911266 CCCTGGTGAGGCTCCTCACAGCC No data
Right 966819162 3:183911258-183911280 CTCACAGCCTCTTCATGGCAGGG No data
966819157_966819167 22 Left 966819157 3:183911244-183911266 CCCTGGTGAGGCTCCTCACAGCC No data
Right 966819167 3:183911289-183911311 CTGCATGGCTCAGCTCAGGGAGG No data
966819157_966819170 30 Left 966819157 3:183911244-183911266 CCCTGGTGAGGCTCCTCACAGCC No data
Right 966819170 3:183911297-183911319 CTCAGCTCAGGGAGGGACAAGGG No data
966819157_966819161 -10 Left 966819157 3:183911244-183911266 CCCTGGTGAGGCTCCTCACAGCC No data
Right 966819161 3:183911257-183911279 CCTCACAGCCTCTTCATGGCAGG No data
966819157_966819166 19 Left 966819157 3:183911244-183911266 CCCTGGTGAGGCTCCTCACAGCC No data
Right 966819166 3:183911286-183911308 TGACTGCATGGCTCAGCTCAGGG No data
966819157_966819164 7 Left 966819157 3:183911244-183911266 CCCTGGTGAGGCTCCTCACAGCC No data
Right 966819164 3:183911274-183911296 GGCAGGGTCAGCTGACTGCATGG No data
966819157_966819169 29 Left 966819157 3:183911244-183911266 CCCTGGTGAGGCTCCTCACAGCC No data
Right 966819169 3:183911296-183911318 GCTCAGCTCAGGGAGGGACAAGG No data
966819157_966819165 18 Left 966819157 3:183911244-183911266 CCCTGGTGAGGCTCCTCACAGCC No data
Right 966819165 3:183911285-183911307 CTGACTGCATGGCTCAGCTCAGG No data
966819157_966819168 23 Left 966819157 3:183911244-183911266 CCCTGGTGAGGCTCCTCACAGCC No data
Right 966819168 3:183911290-183911312 TGCATGGCTCAGCTCAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966819157 Original CRISPR GGCTGTGAGGAGCCTCACCA GGG (reversed) Intergenic
No off target data available for this crispr