ID: 966819158

View in Genome Browser
Species Human (GRCh38)
Location 3:183911245-183911267
Sequence AGGCTGTGAGGAGCCTCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966819158_966819168 22 Left 966819158 3:183911245-183911267 CCTGGTGAGGCTCCTCACAGCCT No data
Right 966819168 3:183911290-183911312 TGCATGGCTCAGCTCAGGGAGGG No data
966819158_966819166 18 Left 966819158 3:183911245-183911267 CCTGGTGAGGCTCCTCACAGCCT No data
Right 966819166 3:183911286-183911308 TGACTGCATGGCTCAGCTCAGGG No data
966819158_966819171 30 Left 966819158 3:183911245-183911267 CCTGGTGAGGCTCCTCACAGCCT No data
Right 966819171 3:183911298-183911320 TCAGCTCAGGGAGGGACAAGGGG No data
966819158_966819167 21 Left 966819158 3:183911245-183911267 CCTGGTGAGGCTCCTCACAGCCT No data
Right 966819167 3:183911289-183911311 CTGCATGGCTCAGCTCAGGGAGG No data
966819158_966819169 28 Left 966819158 3:183911245-183911267 CCTGGTGAGGCTCCTCACAGCCT No data
Right 966819169 3:183911296-183911318 GCTCAGCTCAGGGAGGGACAAGG No data
966819158_966819165 17 Left 966819158 3:183911245-183911267 CCTGGTGAGGCTCCTCACAGCCT No data
Right 966819165 3:183911285-183911307 CTGACTGCATGGCTCAGCTCAGG No data
966819158_966819164 6 Left 966819158 3:183911245-183911267 CCTGGTGAGGCTCCTCACAGCCT No data
Right 966819164 3:183911274-183911296 GGCAGGGTCAGCTGACTGCATGG No data
966819158_966819162 -10 Left 966819158 3:183911245-183911267 CCTGGTGAGGCTCCTCACAGCCT No data
Right 966819162 3:183911258-183911280 CTCACAGCCTCTTCATGGCAGGG No data
966819158_966819170 29 Left 966819158 3:183911245-183911267 CCTGGTGAGGCTCCTCACAGCCT No data
Right 966819170 3:183911297-183911319 CTCAGCTCAGGGAGGGACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966819158 Original CRISPR AGGCTGTGAGGAGCCTCACC AGG (reversed) Intergenic
No off target data available for this crispr