ID: 966819160

View in Genome Browser
Species Human (GRCh38)
Location 3:183911257-183911279
Sequence CCTGCCATGAAGAGGCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966819160_966819164 -6 Left 966819160 3:183911257-183911279 CCTCACAGCCTCTTCATGGCAGG No data
Right 966819164 3:183911274-183911296 GGCAGGGTCAGCTGACTGCATGG No data
966819160_966819167 9 Left 966819160 3:183911257-183911279 CCTCACAGCCTCTTCATGGCAGG No data
Right 966819167 3:183911289-183911311 CTGCATGGCTCAGCTCAGGGAGG No data
966819160_966819170 17 Left 966819160 3:183911257-183911279 CCTCACAGCCTCTTCATGGCAGG No data
Right 966819170 3:183911297-183911319 CTCAGCTCAGGGAGGGACAAGGG No data
966819160_966819169 16 Left 966819160 3:183911257-183911279 CCTCACAGCCTCTTCATGGCAGG No data
Right 966819169 3:183911296-183911318 GCTCAGCTCAGGGAGGGACAAGG No data
966819160_966819166 6 Left 966819160 3:183911257-183911279 CCTCACAGCCTCTTCATGGCAGG No data
Right 966819166 3:183911286-183911308 TGACTGCATGGCTCAGCTCAGGG No data
966819160_966819172 22 Left 966819160 3:183911257-183911279 CCTCACAGCCTCTTCATGGCAGG No data
Right 966819172 3:183911302-183911324 CTCAGGGAGGGACAAGGGGCAGG No data
966819160_966819168 10 Left 966819160 3:183911257-183911279 CCTCACAGCCTCTTCATGGCAGG No data
Right 966819168 3:183911290-183911312 TGCATGGCTCAGCTCAGGGAGGG No data
966819160_966819171 18 Left 966819160 3:183911257-183911279 CCTCACAGCCTCTTCATGGCAGG No data
Right 966819171 3:183911298-183911320 TCAGCTCAGGGAGGGACAAGGGG No data
966819160_966819165 5 Left 966819160 3:183911257-183911279 CCTCACAGCCTCTTCATGGCAGG No data
Right 966819165 3:183911285-183911307 CTGACTGCATGGCTCAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966819160 Original CRISPR CCTGCCATGAAGAGGCTGTG AGG (reversed) Intergenic
No off target data available for this crispr