ID: 966819164

View in Genome Browser
Species Human (GRCh38)
Location 3:183911274-183911296
Sequence GGCAGGGTCAGCTGACTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966819158_966819164 6 Left 966819158 3:183911245-183911267 CCTGGTGAGGCTCCTCACAGCCT No data
Right 966819164 3:183911274-183911296 GGCAGGGTCAGCTGACTGCATGG No data
966819157_966819164 7 Left 966819157 3:183911244-183911266 CCCTGGTGAGGCTCCTCACAGCC No data
Right 966819164 3:183911274-183911296 GGCAGGGTCAGCTGACTGCATGG No data
966819155_966819164 20 Left 966819155 3:183911231-183911253 CCTCGGAGCTCATCCCTGGTGAG No data
Right 966819164 3:183911274-183911296 GGCAGGGTCAGCTGACTGCATGG No data
966819160_966819164 -6 Left 966819160 3:183911257-183911279 CCTCACAGCCTCTTCATGGCAGG No data
Right 966819164 3:183911274-183911296 GGCAGGGTCAGCTGACTGCATGG No data
966819154_966819164 21 Left 966819154 3:183911230-183911252 CCCTCGGAGCTCATCCCTGGTGA No data
Right 966819164 3:183911274-183911296 GGCAGGGTCAGCTGACTGCATGG No data
966819152_966819164 28 Left 966819152 3:183911223-183911245 CCTCTGGCCCTCGGAGCTCATCC No data
Right 966819164 3:183911274-183911296 GGCAGGGTCAGCTGACTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966819164 Original CRISPR GGCAGGGTCAGCTGACTGCA TGG Intergenic
No off target data available for this crispr