ID: 966819168

View in Genome Browser
Species Human (GRCh38)
Location 3:183911290-183911312
Sequence TGCATGGCTCAGCTCAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966819163_966819168 2 Left 966819163 3:183911265-183911287 CCTCTTCATGGCAGGGTCAGCTG No data
Right 966819168 3:183911290-183911312 TGCATGGCTCAGCTCAGGGAGGG No data
966819158_966819168 22 Left 966819158 3:183911245-183911267 CCTGGTGAGGCTCCTCACAGCCT No data
Right 966819168 3:183911290-183911312 TGCATGGCTCAGCTCAGGGAGGG No data
966819157_966819168 23 Left 966819157 3:183911244-183911266 CCCTGGTGAGGCTCCTCACAGCC No data
Right 966819168 3:183911290-183911312 TGCATGGCTCAGCTCAGGGAGGG No data
966819160_966819168 10 Left 966819160 3:183911257-183911279 CCTCACAGCCTCTTCATGGCAGG No data
Right 966819168 3:183911290-183911312 TGCATGGCTCAGCTCAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966819168 Original CRISPR TGCATGGCTCAGCTCAGGGA GGG Intergenic
No off target data available for this crispr