ID: 966819169

View in Genome Browser
Species Human (GRCh38)
Location 3:183911296-183911318
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966819163_966819169 8 Left 966819163 3:183911265-183911287 CCTCTTCATGGCAGGGTCAGCTG No data
Right 966819169 3:183911296-183911318 GCTCAGCTCAGGGAGGGACAAGG No data
966819158_966819169 28 Left 966819158 3:183911245-183911267 CCTGGTGAGGCTCCTCACAGCCT No data
Right 966819169 3:183911296-183911318 GCTCAGCTCAGGGAGGGACAAGG No data
966819157_966819169 29 Left 966819157 3:183911244-183911266 CCCTGGTGAGGCTCCTCACAGCC No data
Right 966819169 3:183911296-183911318 GCTCAGCTCAGGGAGGGACAAGG No data
966819160_966819169 16 Left 966819160 3:183911257-183911279 CCTCACAGCCTCTTCATGGCAGG No data
Right 966819169 3:183911296-183911318 GCTCAGCTCAGGGAGGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr