ID: 966819171

View in Genome Browser
Species Human (GRCh38)
Location 3:183911298-183911320
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966819158_966819171 30 Left 966819158 3:183911245-183911267 CCTGGTGAGGCTCCTCACAGCCT No data
Right 966819171 3:183911298-183911320 TCAGCTCAGGGAGGGACAAGGGG No data
966819160_966819171 18 Left 966819160 3:183911257-183911279 CCTCACAGCCTCTTCATGGCAGG No data
Right 966819171 3:183911298-183911320 TCAGCTCAGGGAGGGACAAGGGG No data
966819163_966819171 10 Left 966819163 3:183911265-183911287 CCTCTTCATGGCAGGGTCAGCTG No data
Right 966819171 3:183911298-183911320 TCAGCTCAGGGAGGGACAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr