ID: 966819172

View in Genome Browser
Species Human (GRCh38)
Location 3:183911302-183911324
Sequence CTCAGGGAGGGACAAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966819163_966819172 14 Left 966819163 3:183911265-183911287 CCTCTTCATGGCAGGGTCAGCTG No data
Right 966819172 3:183911302-183911324 CTCAGGGAGGGACAAGGGGCAGG No data
966819160_966819172 22 Left 966819160 3:183911257-183911279 CCTCACAGCCTCTTCATGGCAGG No data
Right 966819172 3:183911302-183911324 CTCAGGGAGGGACAAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966819172 Original CRISPR CTCAGGGAGGGACAAGGGGC AGG Intergenic
No off target data available for this crispr