ID: 966819173

View in Genome Browser
Species Human (GRCh38)
Location 3:183911318-183911340
Sequence GGGCAGGCAGCCGCTAGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966819163_966819173 30 Left 966819163 3:183911265-183911287 CCTCTTCATGGCAGGGTCAGCTG No data
Right 966819173 3:183911318-183911340 GGGCAGGCAGCCGCTAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966819173 Original CRISPR GGGCAGGCAGCCGCTAGCAG TGG Intergenic
No off target data available for this crispr