ID: 966821844

View in Genome Browser
Species Human (GRCh38)
Location 3:183930949-183930971
Sequence TATGCTCCAGGGAGCCCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966821839_966821844 -6 Left 966821839 3:183930932-183930954 CCTTTCATCCACAAGGATATGCT 0: 1
1: 0
2: 0
3: 9
4: 148
Right 966821844 3:183930949-183930971 TATGCTCCAGGGAGCCCCGGTGG 0: 1
1: 0
2: 1
3: 15
4: 143
966821836_966821844 -3 Left 966821836 3:183930929-183930951 CCCCCTTTCATCCACAAGGATAT 0: 1
1: 0
2: 2
3: 19
4: 170
Right 966821844 3:183930949-183930971 TATGCTCCAGGGAGCCCCGGTGG 0: 1
1: 0
2: 1
3: 15
4: 143
966821833_966821844 24 Left 966821833 3:183930902-183930924 CCTCTGGATCAAAGAGCAGGCAT 0: 1
1: 2
2: 9
3: 37
4: 191
Right 966821844 3:183930949-183930971 TATGCTCCAGGGAGCCCCGGTGG 0: 1
1: 0
2: 1
3: 15
4: 143
966821838_966821844 -5 Left 966821838 3:183930931-183930953 CCCTTTCATCCACAAGGATATGC 0: 1
1: 0
2: 1
3: 8
4: 170
Right 966821844 3:183930949-183930971 TATGCTCCAGGGAGCCCCGGTGG 0: 1
1: 0
2: 1
3: 15
4: 143
966821837_966821844 -4 Left 966821837 3:183930930-183930952 CCCCTTTCATCCACAAGGATATG 0: 1
1: 0
2: 1
3: 20
4: 245
Right 966821844 3:183930949-183930971 TATGCTCCAGGGAGCCCCGGTGG 0: 1
1: 0
2: 1
3: 15
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966821844 Original CRISPR TATGCTCCAGGGAGCCCCGG TGG Intronic
900655689 1:3755705-3755727 TCTGCACAAGGGAGGCCCGGAGG - Intronic
901266472 1:7914293-7914315 TGTGCACCAGGGAGCTCCGCTGG - Intergenic
901501885 1:9657572-9657594 TCTGCTCCTGGGACCCCAGGAGG - Intronic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
908422577 1:63973315-63973337 TATGCTCTGGGCAGCCCAGGGGG - Intronic
912343199 1:108937918-108937940 TGTGGCCCAGGGACCCCCGGGGG + Intronic
913396879 1:118381375-118381397 TATCCTCCAGGGAGTGCCTGTGG + Intergenic
915091438 1:153429004-153429026 GATGCTCCAGGGGGCACTGGAGG + Intergenic
917070825 1:171148863-171148885 GATGATCCAGTGAGCCCCAGTGG - Intronic
920345709 1:205304448-205304470 CATCCTCCAGGGTGGCCCGGCGG + Exonic
1065520439 10:26566745-26566767 TATTCTCAAGGCAGCCCCAGTGG - Intronic
1069640974 10:69955383-69955405 AGTGCTCAAGGGAGCCCCTGCGG - Intronic
1070385032 10:75916557-75916579 TATGTGCCAGGCAGCCCTGGTGG - Intronic
1070488979 10:76958108-76958130 TGTGATCCAGGGAGACCCAGAGG + Intronic
1072640154 10:97205545-97205567 TGTGCTCCAGGCAGCCCCTCTGG - Intronic
1072954136 10:99874052-99874074 TATGCTACAGGCAGGCCTGGGGG + Intergenic
1074120545 10:110490840-110490862 TATGCTCCAGGGATAGCCGGTGG + Intergenic
1074240778 10:111637048-111637070 TATGCTCCATAGTGCCCTGGAGG + Intergenic
1074848594 10:117420752-117420774 TCTGCTCCTGGGAGCCATGGAGG - Intergenic
1075677856 10:124308667-124308689 CAGGCTCCAAGGAGCCCTGGAGG - Intergenic
1077492556 11:2868858-2868880 TATGCTTCAGGGTGCCTCCGAGG - Intergenic
1078320584 11:10331094-10331116 CAAGCTCCAGGGAGCCCCACAGG - Intronic
1080685944 11:34514839-34514861 AGGGCTCCAGGGAGCCCCTGGGG - Intergenic
1081615851 11:44590821-44590843 CAAGCTCCAAGGAGCCCCCGAGG - Intronic
1084179655 11:67440010-67440032 CTTGCGCCAGGGAGGCCCGGCGG - Intronic
1084190681 11:67497391-67497413 CCTCCTCCTGGGAGCCCCGGCGG - Exonic
1084411659 11:69009446-69009468 TGTGCTCCATGGAGCCTAGGGGG - Intronic
1084518941 11:69651123-69651145 TCTGCTCCTGGCAGGCCCGGAGG - Exonic
1085529356 11:77182414-77182436 TCTGCCCCAGGCAGCCCTGGCGG + Exonic
1087009615 11:93500920-93500942 GATGCTCCAGTGAGCCCCTGGGG - Intronic
1087902867 11:103662244-103662266 TATGCTCCTGGAAGCCCTGTTGG + Intergenic
1089458496 11:118639445-118639467 TAGGCTCCTGGGAACCCCAGAGG - Intronic
1090350402 11:126104411-126104433 CATGTCCCAGGGAGCCCCTGAGG - Intergenic
1090411898 11:126515048-126515070 GATGCTCCCAGGAGACCCGGTGG + Intronic
1095956834 12:47811758-47811780 TATGGTCCAAGAAGACCCGGGGG - Intronic
1096196760 12:49653590-49653612 TATGCTCTTGAGAGCCCTGGTGG + Intronic
1098973587 12:76879317-76879339 TCCCCTCCAGGGAGGCCCGGCGG + Intergenic
1098974549 12:76888996-76889018 TAAGCTCCAGGCAGCCACAGTGG - Intergenic
1101315261 12:103623189-103623211 GATGCCCCAGGGAGCTCTGGGGG + Intronic
1101796350 12:107978181-107978203 CATGTTCCATGGAGCCCCTGTGG + Intergenic
1103726437 12:122999604-122999626 GATGATCCAGGGACCCCCAGAGG + Intronic
1108077869 13:46700416-46700438 TATGCTGCTGAGAGCCACGGAGG + Intronic
1113456171 13:110450421-110450443 GGTGGTCCAGGGAGCCCGGGGGG - Exonic
1114139572 14:19894876-19894898 TATTCTCCAGGGAGCAGCAGAGG + Intergenic
1115542869 14:34439112-34439134 TATGCTCCAGAGTGCCCTGTGGG - Intronic
1119439533 14:74619054-74619076 TATGCTTCAGGCTCCCCCGGGGG - Intergenic
1122419320 14:101565116-101565138 GAAGCTCCAGGAAGCCCAGGGGG - Intergenic
1122634781 14:103124757-103124779 CATGCTCCAGGGAGCCCCAGGGG - Intronic
1122900776 14:104781512-104781534 TACTTTCCAGGGAGCCACGGGGG + Intronic
1127605146 15:60579299-60579321 TGTGATCCAGGGACCCCCTGCGG - Intronic
1129064299 15:72888455-72888477 TGTGCTCCAGGGCACCCCAGGGG + Intergenic
1132513251 16:354118-354140 GATGCTCCAGGCAGCCCCCTGGG + Intergenic
1134302996 16:13008096-13008118 AATGCTCTAGGGAGCACTGGTGG + Intronic
1136509629 16:30728959-30728981 TTTCCTCCAGGGAGTCCTGGGGG - Exonic
1138329258 16:56200231-56200253 CTTGCTTCAGGGAGCCCTGGTGG - Intronic
1139322802 16:66129090-66129112 TATGCTCCAGGGTCCCCCAGGGG - Intergenic
1141516332 16:84547742-84547764 TAGGCTCCATGGAGGCCCAGAGG + Intronic
1142031116 16:87839055-87839077 CTTGCTCCAGGGAGTCCCAGAGG - Intronic
1142116548 16:88359180-88359202 TCTGCTTCAGAGAGTCCCGGGGG + Intergenic
1142227747 16:88885734-88885756 GATGCTCCGGGGAGCCTAGGAGG - Intronic
1142765988 17:2064660-2064682 TGTGCCCCAGGGACCCCTGGGGG + Intronic
1144650832 17:17005752-17005774 TTTGCTCCAGAGACCCCCTGGGG - Intergenic
1147132184 17:38415906-38415928 TGTTCCCCAGGGAGCCCTGGAGG + Intergenic
1147246248 17:39123020-39123042 TGTGCTCCATGGAACCCCGAGGG - Intronic
1151266147 17:72956937-72956959 GATGCACCAGTGAGCCCAGGTGG - Intronic
1152238073 17:79148775-79148797 GAGGCTGCAGGGAGCCCCGGCGG - Intronic
1156586181 18:38433685-38433707 TTTCCTCCTGGGAGCCCGGGTGG - Intergenic
1157562614 18:48659501-48659523 ACAGCTCCAGGGAGCCCTGGGGG - Intronic
1160452465 18:78974567-78974589 TGCGCTCCCGGGAGCGCCGGCGG - Intergenic
1161103373 19:2432226-2432248 CAGGCTCCAGGGAGGCCCAGTGG + Intronic
1163005516 19:14394690-14394712 TGAGCTCATGGGAGCCCCGGTGG - Intronic
1164552148 19:29220880-29220902 TGTCCTCCAGGAAGCCCTGGTGG + Intergenic
1167716053 19:51143474-51143496 GGTGCTCCAGGGAAGCCCGGAGG + Intronic
1168104183 19:54156599-54156621 TGTGGTCCAGGGAGCCCTAGGGG - Intronic
925649348 2:6072865-6072887 TTTGCACCAGGAAGCCCAGGAGG + Intergenic
926684954 2:15691227-15691249 GCTGCTGCAGGGAGACCCGGCGG + Intronic
935222457 2:101027271-101027293 TCTGCTCCACGGAGCCCTGCAGG + Intronic
936234906 2:110733840-110733862 TGTGGTACAGGGAGCCCTGGGGG + Intronic
936743444 2:115544310-115544332 TATGCTGAAGGTAGCCCAGGAGG - Intronic
938467460 2:131532899-131532921 GAGGCCCCAGGCAGCCCCGGAGG + Exonic
945034546 2:205693355-205693377 CATGTTCCAGGAAGCCCCAGTGG + Intronic
945112504 2:206375774-206375796 AATGCTCCAGGGAGTCCTGCAGG - Intergenic
946411986 2:219520072-219520094 AAGGGTCCAGGCAGCCCCGGGGG + Intronic
948372985 2:237502417-237502439 CAAGCTCCAGGGTGCCCAGGAGG - Intronic
948559882 2:238845823-238845845 ATAGCTCCAGGGCGCCCCGGGGG + Intergenic
948702712 2:239770228-239770250 TATGACCCAGGAAGCCCAGGTGG - Intronic
1170065987 20:12311178-12311200 CATGCTCCATGGATCCCCAGAGG + Intergenic
1171520123 20:25769372-25769394 TAAAGTCCAGGGAGCCCTGGAGG - Intronic
1171556796 20:26087121-26087143 TAAAGTCCAGGGAGCCCTGGAGG + Intergenic
1171810208 20:29741173-29741195 GAGGCGCGAGGGAGCCCCGGAGG + Intergenic
1172962789 20:38810320-38810342 TATCCTGCCGGGAGCCCCGAAGG + Intronic
1174281951 20:49445837-49445859 TCTGGGCCAGGGAGCCCTGGAGG + Intronic
1176142936 20:63553250-63553272 ATAGCTCCAGGGAGCCCCGCAGG - Intronic
1176301792 21:5102121-5102143 GAGGCTCCAGGGAGCCCCGTGGG + Intergenic
1176654258 21:9575658-9575680 TAAAGTCCAGGGAGCCCTGGAGG - Intergenic
1179151233 21:38810058-38810080 TATGGACCAGGTAGCCCCTGTGG + Exonic
1179855239 21:44159779-44159801 GAGGCTCCAGGGAGCCCCGTGGG - Intergenic
1185044792 22:48523495-48523517 TCTGCTTCTGGGAGCCCCGAAGG + Intronic
950579008 3:13850694-13850716 AGTGCACCAGGGAGCTCCGGGGG - Intronic
951255983 3:20450000-20450022 GATGCTCCAGGGACCCTCTGTGG + Intergenic
951600826 3:24372969-24372991 TATGCTCCATGGAGCCTCAAGGG + Intronic
951643451 3:24861871-24861893 TGTGATCCAGGGAGCCCTGGTGG - Intergenic
954136676 3:48585100-48585122 TCTGCTCCAGGGAAGCCCTGAGG + Exonic
957319730 3:78614096-78614118 TATTCTCGAGGGAGCACAGGAGG - Intronic
960381813 3:116971707-116971729 TATCCTCCAGGGAACTCCGCAGG + Intronic
966821844 3:183930949-183930971 TATGCTCCAGGGAGCCCCGGTGG + Intronic
968262689 3:197337884-197337906 TATGCTCCATTAAGCCCCAGGGG + Intergenic
968971785 4:3799526-3799548 CATGCTCCAGGGACACCCAGAGG + Intergenic
969337447 4:6520048-6520070 TATTCCCCAGGGAGCCCCCAAGG + Intronic
970373800 4:15435867-15435889 TTTGCTCCAGGGGGCCCTGGAGG - Exonic
974298176 4:60032373-60032395 AATGCTCAAGGGAGTCCTGGAGG - Intergenic
982168977 4:152643286-152643308 TATGCTCTAGGGAAGCCTGGGGG + Intronic
983515176 4:168648122-168648144 TATGCTCCAGAGAGCACCAGAGG + Intronic
985253394 4:188045018-188045040 TGTGCTACAGGCAGCCCTGGTGG + Intergenic
985788667 5:1913428-1913450 CATGCTCCAGGGAGCCAAGGTGG - Intergenic
988361104 5:30237622-30237644 GATGCTCCAGGGGGCCTCTGTGG - Intergenic
992591037 5:78295654-78295676 TATGCACTAGGGAGCCTAGGCGG + Intergenic
999255300 5:150206646-150206668 TAGACTCCAGGGTGCCCCTGTGG - Intronic
1000198861 5:158987949-158987971 GCTGCTCCAGTGAGCCCCGGGGG - Intronic
1002299984 5:178252545-178252567 TTGGCTCCAGGGATCCCTGGTGG + Exonic
1002871172 6:1168551-1168573 GATGATCCAGGGAACCCCAGAGG + Intergenic
1002960979 6:1914811-1914833 TGTGCTTCAGGGAGGCCCAGTGG - Intronic
1006296578 6:33172567-33172589 TGCTCTCCAGGGGGCCCCGGGGG + Exonic
1017672248 6:156778747-156778769 CATGCTGCCGGGGGCCCCGGCGG - Exonic
1018214361 6:161512774-161512796 TGTGCACCAGGGAGGCCAGGAGG - Intronic
1019645127 7:2124878-2124900 CAAGCTCCAGGGAGGCCCGCTGG - Intronic
1023335670 7:39166658-39166680 AAAGCTCCAGAGAGCCCCAGGGG - Intronic
1023623427 7:42094836-42094858 GTTGCTCCAAGGAGCCCCAGAGG + Intronic
1024549691 7:50552411-50552433 TATTCTCCATGCAGCCCCTGTGG + Intronic
1025280611 7:57624326-57624348 TAAAGTCCAGGGAGCCCTGGAGG - Intergenic
1025304119 7:57841181-57841203 TAAAGTCCAGGGAGCCCTGGAGG + Intergenic
1027741717 7:82016310-82016332 GATGCTCCAGGAAGCACTGGGGG + Intronic
1029569909 7:101362711-101362733 TAGGCTCCAGGGACCTCCTGCGG + Intergenic
1030103140 7:105963508-105963530 GCCGCTCCAGGGAGCCCTGGGGG + Intronic
1033044306 7:137947501-137947523 GAGGCTCAGGGGAGCCCCGGAGG - Intronic
1033842788 7:145395494-145395516 TAAGTTCCAGGGACCCCCCGTGG - Intergenic
1035856917 8:2985838-2985860 TGTGCTCCAGGAGGCCCCAGTGG + Intronic
1036510373 8:9394447-9394469 TGTGCTCCAGGGAATCCTGGGGG - Intergenic
1037740445 8:21604768-21604790 TGTTCTCCAGGGAGGCCTGGAGG + Intergenic
1039921633 8:41897311-41897333 TCTTCCCCAGGGAGCCCCGGAGG - Intergenic
1041298999 8:56391266-56391288 TATGCTCCAGGAAACACCTGAGG + Intergenic
1042982505 8:74546462-74546484 CATGCTCCAGGGAGACCAGAAGG + Intergenic
1044230905 8:89776653-89776675 TGTGGTCCAGGGACCCCTGGCGG - Intronic
1044473276 8:92597243-92597265 TTTGCTACAGGGATCCCCAGTGG + Intergenic
1049010530 8:139884296-139884318 TCTGCTCCTGGGTGCCCCGTTGG + Intronic
1049167551 8:141136064-141136086 TAGGCTCCTGGCAGCCCCGCTGG + Intronic
1049189537 8:141279170-141279192 GATGCTCGTGGGAGCCCCTGTGG + Intronic
1049289181 8:141792443-141792465 TGTGCTCCATGGAGCCCCCAGGG + Intergenic
1051904556 9:22080251-22080273 TTTACTCCAGGGAGCCAGGGAGG - Intergenic
1053121103 9:35548048-35548070 TACGTTCCAGCGAGCCCAGGCGG - Exonic
1053161793 9:35818577-35818599 TGTGAACCAGGGAGCCCCGGGGG + Intronic
1185844298 X:3423092-3423114 GGAGCTCCAGGGAGCCCAGGTGG + Intergenic
1186241380 X:7570680-7570702 TTTGCACAAGTGAGCCCCGGTGG + Intergenic
1192349206 X:70342055-70342077 TATCCTCCAGGGAGCCCCTCTGG + Intronic
1192967101 X:76189594-76189616 AATGCTCCAGTGAGCACTGGGGG + Intergenic
1195110675 X:101645909-101645931 TATGATCCATTGAGCCCGGGAGG + Intergenic
1197175135 X:123477639-123477661 TGTGGTCCAGGGACCCCCGGAGG - Intronic
1197177635 X:123502182-123502204 TTTGCTCCAGAGAGCCCCCTCGG + Intergenic
1199692748 X:150321035-150321057 CTTGCTCCAGGGAGCACAGGTGG - Intergenic
1200090328 X:153632981-153633003 TCTGCTCCAGGGAGCCCGCTGGG - Intergenic