ID: 966822459

View in Genome Browser
Species Human (GRCh38)
Location 3:183935839-183935861
Sequence CTTTGGGTATTGAGGTAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966822459 Original CRISPR CTTTGGGTATTGAGGTAATA AGG (reversed) Intronic
901093369 1:6658808-6658830 CTGTGAGTATTGATGTCATATGG - Intronic
907736284 1:57115795-57115817 CTTTGGGTAATAAGGAAATGGGG + Intronic
910013309 1:82491914-82491936 ATTTGGGTAGTAAGCTAATAGGG - Intergenic
919745092 1:201003875-201003897 CTTTGGGCATTAAGGTAGTGGGG - Intronic
922495347 1:226053040-226053062 CTTTGGGTGTTCAGGAAACATGG + Intergenic
923167184 1:231376998-231377020 CTTTGGATATTGTGCTAAGAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923830367 1:237549202-237549224 ATTTGGGTATTAAGGTATTCAGG + Intronic
1065072977 10:22046752-22046774 CTGTGTCTATTGAGATAATATGG - Intergenic
1073459677 10:103659470-103659492 CTTTGGGTCTTCAGGTACTGGGG + Intronic
1073993775 10:109293200-109293222 TTTTGGCTTTTGGGGTAATATGG - Intergenic
1075676587 10:124300120-124300142 CTTTGGGGATTGGGGAAATGAGG - Intergenic
1077520179 11:3028518-3028540 CTTTGGAGATTGAGACAATACGG + Intronic
1080004009 11:27385431-27385453 CCTCGGGGACTGAGGTAATATGG + Exonic
1085809209 11:79665375-79665397 CTTTGTGTATCCAGGTAAGATGG + Intergenic
1097728729 12:63104152-63104174 CTTTGGGTATAGAAATAATACGG - Intergenic
1098369560 12:69742179-69742201 ATTTGTGCATTGAGGTAATGAGG + Intronic
1098417846 12:70256771-70256793 CTCTGATTATTAAGGTAATATGG + Intronic
1100785931 12:98078195-98078217 CTTTGGGTCTTGTGGTCATTAGG - Intergenic
1107776751 13:43852054-43852076 CTTTGGGTTTTGGGGTTATCAGG - Intronic
1110164706 13:72426346-72426368 CTTAGGGTAATGAAGAAATAAGG - Intergenic
1110413607 13:75228972-75228994 CTTTGGGAAGTGAGGTTATGAGG + Intergenic
1115076358 14:29396594-29396616 TTTTGGCTTTTGAGGTAACATGG + Intergenic
1117203189 14:53413312-53413334 CTTTGGGTGTTAAGATAATAAGG - Intergenic
1118172982 14:63407755-63407777 CTTTTGGTGTTGAGGTCATAAGG + Intronic
1119245906 14:73107810-73107832 CTTTGGCCTTTGAGGAAATAAGG - Exonic
1125344878 15:38709193-38709215 CTTTGTTTATTGACGTAATCAGG + Intergenic
1127231022 15:56995386-56995408 CTTTGGGTACTTAGGTAGTGTGG + Intronic
1127549022 15:60018608-60018630 CTTTAGGTATTAGTGTAATAAGG - Intronic
1128067232 15:64773031-64773053 CTTTAGGAATTGAGGTCTTACGG + Intronic
1129610595 15:77052274-77052296 CTTTGTGTATGTAGGTAATGTGG - Intronic
1133066381 16:3210345-3210367 CTTTGGTTATGGAGGTGATGTGG + Intergenic
1138951856 16:61921729-61921751 CTTTGGATTTTGAGGTCATGGGG + Intronic
1145113001 17:20181587-20181609 GTTTTGGTATTGATGCAATAAGG + Intronic
1145951836 17:28824591-28824613 CCTTTGGAAGTGAGGTAATAAGG - Intronic
1147263634 17:39222839-39222861 CGTGGGGAATTGAGGAAATAAGG - Intronic
1147566774 17:41541266-41541288 CCTTTGGTCTTGAGGTGATAAGG - Intergenic
1149093946 17:52817824-52817846 CTTTGGTAATTCAGGAAATATGG - Intergenic
1150055707 17:62013428-62013450 CTATAGTTATTGAGATAATATGG - Intronic
1150525421 17:65917461-65917483 TCTTCGGTATTGAGGTAATGTGG - Intronic
1154181258 18:12141929-12141951 CTTTTGGTGTTGAGGTTCTAGGG + Intergenic
1154182646 18:12149655-12149677 CTTTTGGTGTTGAGGTTCTAGGG - Intergenic
1159696815 18:71569336-71569358 CTTTGGGTATTGGTGTATTAAGG + Intergenic
1168519590 19:57037978-57038000 CTTTGTGTATTGATGATATAAGG + Intergenic
925706547 2:6689811-6689833 CTTTGGGGACTCAGGTAAAAGGG + Intergenic
926873413 2:17448136-17448158 GTTAAGGTATTCAGGTAATATGG - Intergenic
928327028 2:30327706-30327728 CTTTGGGGTTTTATGTAATATGG + Intergenic
933036131 2:77400816-77400838 GGTTGGGTATTCAGGAAATAGGG - Intronic
939103787 2:137926039-137926061 ATTTGGGTATGGAGATATTATGG - Intergenic
943430607 2:187796331-187796353 CTTTGGGTAGTGATGTAGTTTGG - Intergenic
945713758 2:213332541-213332563 GTTTGGGTATCAGGGTAATATGG - Intronic
1172441231 20:34967994-34968016 CTGTGGGTGTTGGGGTACTATGG - Intergenic
1175636320 20:60587212-60587234 TTTTGTGTATTTAGGTAAAAGGG - Intergenic
1177372000 21:20216341-20216363 TTTTGGGTAATGGGGTTATAAGG - Intergenic
1178750325 21:35296733-35296755 CTTTTGGTTTGGAGGTGATACGG + Intronic
1181133865 22:20750901-20750923 ATTTTGTTATTGTGGTAATAGGG - Intronic
950845073 3:16007488-16007510 CTTTGGGTAGTATGGCAATAAGG + Intergenic
955880791 3:63542855-63542877 TTTTGGTAATTCAGGTAATATGG - Intronic
957602938 3:82361291-82361313 CTTTGGGATTTGAGGCAACATGG + Intergenic
959352952 3:105290992-105291014 CTATGGGTTTTCAGGTAATTAGG + Intergenic
962028261 3:131571808-131571830 CTTTGAATTTTGAGGTAATTTGG - Intronic
962713959 3:138111225-138111247 CTTAGGGTCTTGAAGTAATGGGG + Intronic
964607761 3:158575489-158575511 GTTTGGGGGTTGAGGTAAAACGG - Intronic
964814717 3:160704465-160704487 CTCTCTGTACTGAGGTAATAAGG + Intergenic
965152292 3:164993461-164993483 CTTTGGGTATTGTTTTAATTTGG + Intronic
965396921 3:168171241-168171263 GTTTGAGTATTAAGGTAATATGG + Intergenic
966822459 3:183935839-183935861 CTTTGGGTATTGAGGTAATAAGG - Intronic
968173673 3:196530064-196530086 CTTTGGGTATTCAGGGGAAAGGG - Intergenic
969546635 4:7834342-7834364 CTTTGGGGATTCAGGGAAAAAGG + Intronic
970628364 4:17914799-17914821 CTTTGGGAAGTGAAGAAATAAGG - Intronic
971982635 4:33773027-33773049 CTTTGGGAATTGTTGTAACATGG - Intergenic
972254338 4:37337023-37337045 TTTTGGGCATTGTGTTAATAGGG + Intronic
974365465 4:60942943-60942965 CTTGGGGTAGTCAGGTCATATGG + Intergenic
975011026 4:69352125-69352147 ATCTGGTTATTGAGGTAATTAGG + Intronic
977637788 4:99320205-99320227 CTTTGGGGACTGAGGGAAAAGGG - Intronic
978564343 4:110065993-110066015 CTTTGGTTATTGAGTTAGTAGGG - Intronic
979077119 4:116285869-116285891 CTTTGGTCCTTGAGGCAATATGG - Intergenic
980401319 4:132289643-132289665 GTTTTGGTATTAGGGTAATATGG + Intergenic
980679736 4:136142895-136142917 ATTGAGGTATTGAGGTAATCAGG + Intergenic
980731309 4:136827549-136827571 ATTTCTTTATTGAGGTAATAGGG + Intergenic
982712805 4:158774806-158774828 CTTTGGATTTTGAGGGAATGTGG + Intronic
983643112 4:169961993-169962015 CTTTGGGTGTTGGGGCATTAGGG + Intergenic
986277539 5:6291239-6291261 ATTTAGGTATTAAGGTAATCTGG - Intergenic
987996099 5:25281692-25281714 GTTCTGGTATTGAGCTAATAAGG - Intergenic
988355447 5:30168035-30168057 ATTTTGGTATTAGGGTAATATGG - Intergenic
988716107 5:33829817-33829839 CTTTGGGAATTGAGGAAAGCTGG - Intronic
995272269 5:110235294-110235316 CCTTGGGCTTTAAGGTAATATGG + Intergenic
1000015925 5:157276367-157276389 CTGTGTGTATTGAGATGATATGG + Intronic
1003068514 6:2924377-2924399 CTTTAGGTAGTGAGGAAACACGG - Intergenic
1008637968 6:53431411-53431433 TTTGGGGTATTTAGGTCATAAGG + Intergenic
1009372907 6:62930004-62930026 GTTTGGGTATTCAGTTAATGTGG - Intergenic
1014148063 6:118021167-118021189 CTCTGGGGATTGAGATAAAAGGG + Intronic
1015413885 6:132926572-132926594 ATATAGGTTTTGAGGTAATACGG + Intergenic
1015503789 6:133960675-133960697 CTTTGGGTATAGAGGAAAAATGG + Intronic
1017401098 6:154063994-154064016 CTTTGGGTATTTGGATCATATGG + Intronic
1017482388 6:154870765-154870787 TTTTGGGTATTATGGTAATACGG - Intronic
1021011194 7:15468793-15468815 GTTTGTGGATTGAGGTAATCCGG + Intronic
1023138356 7:37076549-37076571 GTTTGGGTTTTCAGGTGATAAGG - Intronic
1025768258 7:64479456-64479478 GTTTTGGTATTGGGGTGATATGG + Intergenic
1028769926 7:94607306-94607328 GTTTTGGTATTAAGGTAATTTGG - Intronic
1031542034 7:123006133-123006155 CTTTGTGTATTTGGGTACTAAGG - Intergenic
1032024012 7:128427084-128427106 GTTTGGGAATTGTGGTATTAGGG - Intergenic
1032375494 7:131411977-131411999 CTTAGGGTACTGAGGTAGAAGGG + Intronic
1033880033 7:145869826-145869848 CTTTCAGTATTGAGGTCATGTGG - Intergenic
1039674315 8:39643473-39643495 CTTTGGGTTTTGATATATTAGGG + Intronic
1044185732 8:89249391-89249413 CTTTGGGTATGTATGCAATATGG + Intergenic
1045072796 8:98527969-98527991 TTTTGGGGATTGAGTAAATAAGG - Intronic
1045795801 8:106042405-106042427 CTTTGGGACTTGAGGGCATATGG + Intergenic
1047945663 8:129876260-129876282 TTTTGGGTACTGAGGTGAAAGGG + Intronic
1048160333 8:132014750-132014772 CTTTGGGAATTGATCTAACATGG + Intergenic
1048403335 8:134093262-134093284 ATTTGGTTATTGAGGGAATGGGG + Intergenic
1048407319 8:134136902-134136924 CTTGGGGTGTGGAGGTCATATGG + Intergenic
1048905457 8:139083926-139083948 CTGTGGGGAATGAGGGAATAAGG - Intergenic
1050955262 9:11649442-11649464 TTTTGTTTTTTGAGGTAATATGG + Intergenic
1054957360 9:70928070-70928092 ATCTGGATATTTAGGTAATAGGG + Intronic
1057533343 9:95874870-95874892 TTTTGGTTATTGTGGCAATAGGG + Intergenic
1058219830 9:102284792-102284814 CTTTGGGGATTGAGGGGAAAAGG + Intergenic
1058557985 9:106190998-106191020 CTTTGGGTAGTAGGGTAGTATGG + Intergenic
1059074616 9:111179481-111179503 CCTTGGATTTTGAGGGAATAGGG - Intergenic
1186061353 X:5710775-5710797 CATTTGGTATTGTGGTAAAAAGG - Intergenic
1188137841 X:26511762-26511784 CTTTTGATATTGAGGCAATTTGG + Intergenic
1189026816 X:37403797-37403819 GTTTGGGGCTTGAGGTGATATGG + Intronic
1191909105 X:66128264-66128286 CTGTGTCTATTGAGATAATAAGG + Intergenic
1193280049 X:79637265-79637287 CTTTTGGTATCAGGGTAATATGG + Intergenic
1193339345 X:80328833-80328855 CTATGGGTATCCTGGTAATAAGG + Intergenic
1194100636 X:89699533-89699555 CTTGGGGTTTTGATTTAATATGG + Intergenic
1195724420 X:107899459-107899481 CTTTGGGCTGGGAGGTAATAGGG + Intronic
1196316856 X:114237057-114237079 CTTTGGGATTTGAGATAATATGG - Intergenic
1196651903 X:118176574-118176596 CTTTGGGCATTTAGCTAAAAAGG + Intergenic
1197004886 X:121483377-121483399 ATTTGGGTAGTGAAGGAATAGGG - Intergenic
1197556347 X:127959690-127959712 CTTTGGGAATTCAGGGGATAAGG - Intergenic
1200453591 Y:3360593-3360615 CTTGGGGTTTTGATTTAATATGG + Intergenic