ID: 966824681

View in Genome Browser
Species Human (GRCh38)
Location 3:183953647-183953669
Sequence TATTTGGCTTAGGTGTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966824674_966824681 -3 Left 966824674 3:183953627-183953649 CCTGGGAGGCATACTTGACCTAT 0: 1
1: 0
2: 0
3: 7
4: 82
Right 966824681 3:183953647-183953669 TATTTGGCTTAGGTGTGGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 228
966824673_966824681 -2 Left 966824673 3:183953626-183953648 CCCTGGGAGGCATACTTGACCTA 0: 1
1: 0
2: 0
3: 3
4: 89
Right 966824681 3:183953647-183953669 TATTTGGCTTAGGTGTGGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 228
966824672_966824681 -1 Left 966824672 3:183953625-183953647 CCCCTGGGAGGCATACTTGACCT 0: 1
1: 0
2: 1
3: 12
4: 156
Right 966824681 3:183953647-183953669 TATTTGGCTTAGGTGTGGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966824681 Original CRISPR TATTTGGCTTAGGTGTGGGG TGG Intronic
901683279 1:10928791-10928813 TATTTGGAAGAGGTGTGGGCAGG - Intergenic
903983051 1:27203751-27203773 CATTTGCCTTTGGTGTTGGGTGG - Intergenic
908224629 1:62043711-62043733 TGTTTGGTTTTGGTTTGGGGGGG + Intronic
908607586 1:65816249-65816271 GATTTGGTTTTGGGGTGGGGTGG + Intronic
909999499 1:82325625-82325647 TATTTTGCTTGTCTGTGGGGAGG + Intergenic
913379315 1:118191366-118191388 TATGTGGCTTAGGTGAAGAGTGG + Intergenic
915072491 1:153282397-153282419 AATTTGGAATAGGTGTGGTGTGG + Intergenic
915925567 1:160016368-160016390 TATTTTGCATATGTCTGGGGTGG - Intergenic
915951286 1:160191302-160191324 TATTTGACTTAGGTTTGGCTAGG + Intronic
916823233 1:168420216-168420238 TATTTGGGTTGGTTGGGGGGTGG + Intergenic
916905324 1:169277119-169277141 ATTTTGGAATAGGTGTGGGGTGG + Intronic
918826256 1:189328699-189328721 TTTTTGGAATAGGTGTGGTGTGG + Intergenic
919914704 1:202132323-202132345 CATTTTGCTTAGGAGTTGGGAGG + Exonic
920511532 1:206555851-206555873 GATTTGGCTTAGGTGGGAGAGGG + Intronic
921541984 1:216427646-216427668 TATTTGACCTAGGTGTCTGGAGG + Intergenic
922248214 1:223821225-223821247 CATTTGGCTGAAGTGTGGTGTGG - Exonic
923466712 1:234254158-234254180 TATTTGGCTTGTCTGTGGGCTGG + Intronic
1063425096 10:5944590-5944612 TGATTGGCTTAGGAGTGGGCAGG - Intronic
1063474296 10:6315094-6315116 TGTTTGGCCTAGGGGTGGGCAGG - Intergenic
1063951720 10:11229543-11229565 TATTTGGCTGTGGTGTGGCCTGG - Intronic
1066927478 10:41715727-41715749 TTTTTGGAATAGGTGTGGTGTGG - Intergenic
1067154604 10:43767345-43767367 TATTTGGTTTTGGTTTGGGTTGG - Intergenic
1068769868 10:60809106-60809128 TATTCCACTGAGGTGTGGGGAGG - Intergenic
1070849998 10:79555903-79555925 TATTCAGCTCAGGGGTGGGGTGG + Exonic
1070857202 10:79615382-79615404 TATTCAGCTCAGGAGTGGGGTGG - Exonic
1073025052 10:100481821-100481843 TAATTGGGTTGGGGGTGGGGGGG - Intronic
1075442047 10:122487713-122487735 CATCTGGCCTAGGTGTGGAGTGG - Intronic
1076870159 10:133189051-133189073 CAATTGGCTTTGGAGTGGGGAGG + Intronic
1077410684 11:2402599-2402621 GTTTTGGTTTAGGTGTGGCGTGG + Exonic
1079620715 11:22550859-22550881 TTTTTAGCTTAGGTGTGTGTGGG - Intergenic
1079788479 11:24706225-24706247 TATATTGGCTAGGTGTGGGGTGG + Intronic
1083408834 11:62477899-62477921 TAATTGGCTTAGGGGATGGGGGG + Intronic
1085188859 11:74600292-74600314 TATTTGGCTTAGGCTGGGCGCGG + Intronic
1085667550 11:78428387-78428409 TATCTGGCTGGGGGGTGGGGTGG + Intergenic
1086883099 11:92172122-92172144 ATTTTGGCATAGGTGTGGTGTGG - Intergenic
1087452738 11:98345559-98345581 AATTTGGAATAGGTGTGGTGTGG + Intergenic
1087765778 11:102151722-102151744 TGTTTGGCTTAGGTTTAGTGCGG + Intronic
1088334047 11:108683864-108683886 TATTTGTTTTTGGTGGGGGGTGG + Intronic
1088430222 11:109750571-109750593 TATTTGGCTGAGGTGTGTCGAGG + Intergenic
1088537500 11:110877042-110877064 CATTTGGGTTTGATGTGGGGTGG + Intergenic
1089565915 11:119371691-119371713 TATTTGTCCTAGGAGTAGGGAGG + Intronic
1090259457 11:125308249-125308271 TCCTTGGCTTATGTGTGGGCTGG + Intronic
1091175673 11:133555165-133555187 ATTTTGGCTTAGGTGTCAGGAGG + Intergenic
1091537047 12:1420904-1420926 TGTTTGGTTTTGGTTTGGGGGGG + Intronic
1091629199 12:2146554-2146576 TCTTTGGGAAAGGTGTGGGGAGG + Intronic
1093328404 12:17807191-17807213 ATTTTGGAATAGGTGTGGGGTGG - Intergenic
1093931850 12:24961685-24961707 TATTTGCCATAGGCCTGGGGTGG + Intergenic
1094276054 12:28676414-28676436 ATTTTGGATTAGGTGTGGTGTGG + Intergenic
1095087420 12:38072779-38072801 ATTTTGGATTAGGTGTGGTGTGG + Intergenic
1095089887 12:38094025-38094047 ATTTTGGATTAGGTGTGGTGTGG - Intergenic
1095244187 12:39899912-39899934 ATTTTGGAATAGGTGTGGGGTGG + Intronic
1095346625 12:41157721-41157743 TTTTTGTCTAAGGTGTGAGGAGG + Intergenic
1095873906 12:47059416-47059438 GTTTTGGATTAGGTGTGGTGTGG - Intergenic
1096032918 12:48436469-48436491 AATTTGGAATAGGTGTGGTGTGG - Intergenic
1099641402 12:85290790-85290812 AATATGGCTTAGGTGAGGGAGGG - Intronic
1100648339 12:96556352-96556374 TATTTCTCCTAGGTGTGGTGTGG - Intronic
1102557848 12:113740371-113740393 TATTAGGGCTAGGTCTGGGGTGG + Intergenic
1102829812 12:115987413-115987435 TATTTGACTTAGGAGTCAGGAGG + Intronic
1104473137 12:129047239-129047261 TGTTTGGCTTTGTTTTGGGGAGG - Intergenic
1107245551 13:38289618-38289640 ATTTTGGAATAGGTGTGGGGTGG - Intergenic
1109700885 13:66023393-66023415 AATTTGGAATAGGTGTGGTGTGG + Intergenic
1109782811 13:67134644-67134666 TATAAGGCTGAGTTGTGGGGTGG + Intronic
1113983273 13:114294260-114294282 TGTTTGGTTTTGGTGGGGGGGGG + Intronic
1114412354 14:22513048-22513070 TATTTGGCTCAGCTGTGGAAAGG - Intergenic
1115832115 14:37354338-37354360 ATTTTGGATTAGGTGTGGTGTGG + Intronic
1117512720 14:56470084-56470106 TTTTTTGCTTAGGTCTTGGGTGG + Intergenic
1117658534 14:57981087-57981109 TCTTTGGCTTCAGTGTGGGAAGG - Intronic
1118200752 14:63669958-63669980 TATTTGACTTTGGGGGGGGGGGG + Intergenic
1122657412 14:103271439-103271461 TGTTTGGCTTTGGTGTGTGTGGG - Intergenic
1123104856 14:105836561-105836583 TGTTTGTGTTTGGTGTGGGGAGG + Intergenic
1123798183 15:23794661-23794683 TATCTGGTTAAGGTGTGAGGGGG + Intergenic
1125002917 15:34790190-34790212 TTTTTGGGGTAGGCGTGGGGTGG - Exonic
1125756845 15:42070478-42070500 TCTTTGGAGTAGGTGTGGGGAGG + Intronic
1126699369 15:51354373-51354395 AATGTGGCTTAGGTGGGGGTAGG - Intronic
1126731826 15:51691406-51691428 TATTGGGCATAGATTTGGGGAGG + Intronic
1128676800 15:69615782-69615804 TGTTTGGGTTGGGGGTGGGGTGG - Intergenic
1129564382 15:76606447-76606469 AATTTGGGGTAGGTGTGGTGTGG + Intronic
1130202528 15:81845490-81845512 TATTTGGTTTAGGAATGTGGTGG - Intergenic
1130947215 15:88557672-88557694 ATTTTGGAATAGGTGTGGGGTGG + Intergenic
1131383521 15:91983638-91983660 TGTTTGGTTGTGGTGTGGGGAGG + Intronic
1131986820 15:98050955-98050977 TATTTGGGAAAGGTGTGGGATGG + Intergenic
1134369552 16:13610304-13610326 CATTTGTCTTAGGTGTGCAGAGG - Intergenic
1134862104 16:17569274-17569296 GCTCTGGCATAGGTGTGGGGAGG - Intergenic
1135625047 16:23987388-23987410 TATTTGGTTGGGGTGGGGGGGGG + Intronic
1136081758 16:27856847-27856869 GATTTGGGTGAGGAGTGGGGTGG + Intronic
1141541602 16:84726988-84727010 TATTTGGTGTAGCTGTGGGAAGG + Intronic
1142384675 16:89755939-89755961 CATGTGGCCTAGGTGTGCGGGGG - Intronic
1142442432 16:90107791-90107813 TATGTAACTTAGGTGTGGAGTGG - Intergenic
1143838030 17:9708496-9708518 CTTTTGGATTAGGTGTGGGGCGG + Intronic
1144344163 17:14334949-14334971 TGTTTTGCTTTGGAGTGGGGAGG + Intronic
1147307588 17:39574367-39574389 TACTTGGTTTGGGCGTGGGGTGG - Intergenic
1148195819 17:45711740-45711762 GATTGGGACTAGGTGTGGGGAGG + Intergenic
1148789149 17:50163772-50163794 TATTGGGCCTAGGGGTGGGAAGG - Intergenic
1148860890 17:50603887-50603909 TGTTTGGGTTGGGAGTGGGGAGG - Intronic
1149572247 17:57680744-57680766 TGTTTGGCTTGGGTGGGGGTGGG + Exonic
1149735606 17:58990862-58990884 TCTTTTTCTTAGGTGTGGTGTGG - Intronic
1152041897 17:77909014-77909036 TCTTGGGGTGAGGTGTGGGGAGG - Intergenic
1152582433 17:81172232-81172254 TATTAGTGTTAGGTGTGGGGTGG + Intergenic
1153000196 18:447954-447976 AATTTGGGTTAGGGGTGGGATGG + Intronic
1153691577 18:7599881-7599903 TCTTTTGCTTAGGTGCTGGGTGG + Intronic
1154458082 18:14548700-14548722 TATTTTTCTGAGTTGTGGGGTGG + Intergenic
1155062139 18:22238123-22238145 TTTTAGGTTTAGGTCTGGGGAGG - Intergenic
1156222282 18:35064791-35064813 TATTTGGCGGTGGTGTTGGGTGG - Intronic
1156879525 18:42060379-42060401 TGTTTGGCATAAGTGTGGGTTGG - Intronic
1157615557 18:48985487-48985509 TATTTGGTATAGGGATGGGGTGG - Intergenic
1158483453 18:57843484-57843506 TATTTGGCTGAGGTGTGACCTGG + Intergenic
1158842679 18:61405207-61405229 TTTCTGCCTTAGGTGTGGGATGG + Intronic
1159812312 18:73030403-73030425 CATTTGTCTCAGGTGAGGGGAGG + Intergenic
1161673072 19:5624915-5624937 AATTTGGCTTAGCTGATGGGAGG - Intronic
1163166097 19:15499304-15499326 TAATTTGCTGAGGTGTGGGAGGG + Intergenic
1163768414 19:19176459-19176481 TACTCAGCTTAGGAGTGGGGAGG - Intronic
1167194856 19:48021322-48021344 TCTTTGGCTTAGGTTTAGGTCGG + Intronic
930207789 2:48605649-48605671 TATATAGCTTAGGTGTGTAGTGG - Intronic
930276213 2:49314134-49314156 AATTTGGAATAGGTGTGGTGTGG - Intergenic
931120547 2:59213765-59213787 TTTTTGTCTTAGGGGTGGTGAGG + Intergenic
931596979 2:63957903-63957925 TAATTGGCTTGGGTGAGGTGTGG + Intronic
931618523 2:64186573-64186595 ACTTTGGCTTGGGTATGGGGTGG + Intergenic
931797030 2:65721211-65721233 GAGTTGGCTTGGGGGTGGGGTGG + Intergenic
932990369 2:76779192-76779214 TGTTTGGAATAGGTGTGGTGTGG + Intronic
937228792 2:120384860-120384882 GATTTGGCTGAGGCCTGGGGAGG - Intergenic
937477055 2:122225170-122225192 TATTTGGCTTAGGAATGGGTGGG + Intergenic
937938216 2:127263657-127263679 TATGTGGAATAGGTGTGGTGAGG + Intronic
939430919 2:142106656-142106678 TTTTTGGGTGAGGTGTGGGGAGG - Intronic
939924105 2:148152370-148152392 AATTTGGAATAGGTGTGGTGCGG + Intronic
940416838 2:153432705-153432727 TTTTTGGCTGGGGGGTGGGGAGG + Intergenic
941018135 2:160380271-160380293 GCTTTGGCTTAGGTGGGGGTGGG - Intronic
943130923 2:183852093-183852115 ATTTTGGCATAGGTGTGGTGTGG - Intergenic
943630674 2:190248351-190248373 TGTATTGCTTAGGAGTGGGGTGG + Intronic
944542189 2:200764939-200764961 TATTTCTCTTAGGTGTTGGCAGG - Intergenic
945990369 2:216391086-216391108 TATTTGGGAAAGGTATGGGGTGG - Intergenic
1172384721 20:34525923-34525945 TATTTGGCATAGCTGGGGGATGG - Intronic
1173854915 20:46244044-46244066 TACTTGGCACAGGTGTGGGGAGG + Intronic
1174875558 20:54223190-54223212 TGTGAGGCTTAGGTGTGTGGGGG - Intronic
1176816074 21:13604604-13604626 TATTTTTCTGAGTTGTGGGGTGG - Intergenic
1177473610 21:21590704-21590726 CATTTGGGTTGGTTGTGGGGTGG - Intergenic
1181830785 22:25558723-25558745 GATTTGGCTTAAGTCTGTGGTGG + Intergenic
1185143898 22:49119010-49119032 CATACGGCCTAGGTGTGGGGTGG + Intergenic
950084886 3:10249898-10249920 TATTGGGCTGAGGTGTGGTCTGG + Intronic
950376588 3:12577277-12577299 TATTTTGCCTAGGAGTGGAGTGG + Intronic
951090886 3:18572844-18572866 TATTTGGATTAAGAGTGGAGTGG - Intergenic
957308562 3:78489712-78489734 AATTTGGAATAGGTGTGGTGTGG - Intergenic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
957959919 3:87236255-87236277 TATATGGGGTAGGTGTGGGAGGG - Intronic
958404028 3:93729492-93729514 AATTTGGAATAGGTGTGGTGTGG + Intergenic
958588439 3:96121153-96121175 TATTTGGCTTATGGGCTGGGTGG + Intergenic
959243883 3:103837657-103837679 CATTTGTCTTAGGTGTGGAAAGG + Intergenic
961937148 3:130597285-130597307 TATTTGGCTTTGGTAGGTGGAGG + Intronic
963227903 3:142881556-142881578 TATATAGCCTAGGTGTGTGGTGG - Intronic
963324489 3:143846906-143846928 TTTTTTGCTTGGGAGTGGGGAGG - Intronic
964686809 3:159404500-159404522 TACTTGTCACAGGTGTGGGGTGG + Intronic
966824681 3:183953647-183953669 TATTTGGCTTAGGTGTGGGGTGG + Intronic
968362704 3:198158751-198158773 TATGTAACTTAGGTGTGGAGTGG - Intergenic
969939066 4:10712299-10712321 TATATGGATCAGGGGTGGGGTGG + Intergenic
971247302 4:24941106-24941128 AATTTGGAATAGGTGTGGTGTGG - Intronic
972159736 4:36208818-36208840 TATTTTGGTTGGGGGTGGGGTGG + Intronic
974687982 4:65256117-65256139 TGGTTGGCTAAGGTGTGGAGAGG + Intergenic
976196832 4:82540353-82540375 TAGGAGGCTGAGGTGTGGGGAGG - Intronic
978487144 4:109268490-109268512 AGTTTGGCTTAGGGGTGGGTAGG + Intronic
979286359 4:118929582-118929604 CATTTGGCTAAAGTGAGGGGCGG - Intronic
979354600 4:119688057-119688079 TATTTGTATGAGGTGTGGGGAGG - Intergenic
981689186 4:147487328-147487350 TATTTGGTCTAGTTGTTGGGAGG + Intronic
982447172 4:155506120-155506142 TATTTGTCTCAGGTGAGCGGAGG + Intergenic
982511427 4:156288019-156288041 TTTTTGGAATAGGTGTGGTGTGG + Intergenic
985310944 4:188597984-188598006 TATTTGGCTTATGTTTCTGGGGG + Intergenic
985610073 5:882697-882719 TGTGTGGCTTATGTGTTGGGAGG - Intronic
985652378 5:1112873-1112895 TATTTGTCATGGGTGGGGGGGGG - Intergenic
988635717 5:32981728-32981750 TAGGTGGGTTAGGGGTGGGGTGG + Intergenic
989086073 5:37677666-37677688 ATTTTGGAATAGGTGTGGGGTGG + Intronic
989729920 5:44636635-44636657 TATATGGCTGGGGTGGGGGGTGG - Intergenic
990622008 5:57570149-57570171 TATTTAGGTGAGGTTTGGGGAGG - Intergenic
990657151 5:57970046-57970068 ATTTTGGAATAGGTGTGGGGTGG + Intergenic
992768293 5:80023684-80023706 TATTTGGCTTATGATTGTGGTGG + Intronic
993676286 5:90819847-90819869 TTTTTGGAATAGGTGTGGTGTGG + Intronic
995010283 5:107249651-107249673 TATTTGGAATAAGTATGGGGAGG - Intergenic
995384216 5:111570733-111570755 TATTTGGTTTGGGTGAGGGGTGG - Intergenic
995384970 5:111578946-111578968 AATTTGGAATAGGTGTGGTGTGG + Intergenic
998176007 5:139902509-139902531 CCTTTAGCTTAGATGTGGGGTGG - Intronic
998766436 5:145493023-145493045 TATGCTGCTTAGGTTTGGGGAGG + Intronic
999501786 5:152154218-152154240 TATTTGACCAATGTGTGGGGAGG + Intergenic
999684791 5:154092495-154092517 TATTAGGCTTAGGGATGGGGGGG + Intronic
1001184100 5:169550837-169550859 TATTTGACTAAGTTGTAGGGTGG + Intergenic
1003207594 6:4027585-4027607 TATTTGGCGGAGGGGTGGGGGGG + Intronic
1003777479 6:9385030-9385052 TTTTTGGCTTAGGGTTGAGGAGG - Intergenic
1003860833 6:10320202-10320224 TATTTGGGTAAGAGGTGGGGTGG - Intergenic
1006611490 6:35296882-35296904 TATTTGGCTTAGGGGGTAGGGGG + Intergenic
1009872087 6:69466237-69466259 TATTTTGCTGAGGTGCTGGGAGG - Intergenic
1015070927 6:129091983-129092005 TATGTGGCTTAGGTGGGGATGGG + Intronic
1016103167 6:140128319-140128341 GCTTTGGCTTAGGAGTGGTGAGG + Intergenic
1017406423 6:154124463-154124485 TGTTTTCCATAGGTGTGGGGTGG + Intronic
1017466345 6:154697251-154697273 TGTTTGCCTTAGGTGAGGAGTGG + Intergenic
1017966759 6:159273636-159273658 TATTGGACTTACATGTGGGGAGG + Intergenic
1019252979 7:29960-29982 TATGTAACTTAGGTGTGGAGTGG + Intergenic
1021969026 7:25950042-25950064 TCTTTGTCTTAGCTGGGGGGTGG - Intergenic
1023575098 7:41618870-41618892 GGTTTGGCTTAGGTGTCTGGAGG + Intergenic
1027500744 7:78947274-78947296 TATTTGGGTGAGGTGAGGGGAGG - Intronic
1027921954 7:84405605-84405627 TTTTTGGAATAGGTGTGGTGTGG - Intronic
1030392112 7:108940967-108940989 ATTTTGGCATAGGTGTGGTGTGG + Intergenic
1030458025 7:109797679-109797701 AATTTGGAATAGGTGTGGTGTGG - Intergenic
1030539800 7:110816397-110816419 AATTTGGAATAGGTGTGGTGTGG + Intronic
1030629136 7:111875958-111875980 TATGTGGATTAGGTGTGTGTGGG - Intronic
1030634163 7:111929641-111929663 TATTTGGCTGAGGTGAAAGGAGG - Intronic
1031429016 7:121643089-121643111 TATTTGGGGTAGGTGGGTGGGGG + Intergenic
1032346868 7:131124623-131124645 TATTGGGCAGAGGGGTGGGGAGG - Intronic
1032994200 7:137427110-137427132 ATTTTGGAATAGGTGTGGGGTGG - Intronic
1034182103 7:149147306-149147328 TCTTGGGCTTCGGTGTGGGGAGG - Intronic
1037074598 8:14698614-14698636 CATTTAGCATATGTGTGGGGGGG + Intronic
1038349922 8:26766607-26766629 CATTTGGATTAGGTGTGCTGAGG - Intronic
1038420297 8:27430234-27430256 TATGTGGCTCTGGTCTGGGGAGG - Intronic
1038772369 8:30494906-30494928 AATTTGGCTTAGTGGTGGGAGGG + Intronic
1039237412 8:35517158-35517180 TATGTGGCTTTGGGGAGGGGAGG - Intronic
1040140371 8:43902713-43902735 ATTTTGGCATAGGTGTGGTGTGG + Intergenic
1040427183 8:47300878-47300900 AATTTGGAATAGGTGTGGTGTGG + Intronic
1042073123 8:64958260-64958282 TTTTTGGAATAGGTGTGGTGTGG - Intergenic
1042274152 8:66985715-66985737 TCTTTGGCTGAGGTGTAGGGGGG + Intronic
1043664235 8:82787927-82787949 TATTTGGCTTATGGTTGTGGAGG + Intergenic
1045706726 8:104932011-104932033 TTTTTGGCTTTGGTATGTGGTGG + Intronic
1047054398 8:121147889-121147911 GATTTGGCTTGGATTTGGGGAGG + Intergenic
1049250260 8:141584551-141584573 TATTTGTCTCAGGTGAGCGGAGG - Intergenic
1050098849 9:2097016-2097038 TATTCTGCCTAAGTGTGGGGTGG + Intronic
1052198234 9:25744423-25744445 TCTTTGGAATAGGTGTGGTGTGG - Intergenic
1054804594 9:69385570-69385592 TGTTTGTTTTAGGTGTGGAGGGG + Intronic
1054808685 9:69417200-69417222 ATTTTGGAATAGGTGTGGGGTGG + Intergenic
1054811465 9:69438209-69438231 ATTTTGGAATAGGTGTGGGGTGG + Intronic
1054830349 9:69618088-69618110 TGTTTGCCTCAGGTGTGGGATGG + Intronic
1056943142 9:90972315-90972337 TAGTTGCCATAGGTGGGGGGTGG - Intergenic
1059653153 9:116334102-116334124 AAGTTGGCTTTGGTGTTGGGTGG - Intronic
1061307136 9:129738627-129738649 TCTCTGGCTCAGGTGTGGGTGGG - Exonic
1062434888 9:136542638-136542660 TAATTGGCTTCAGTTTGGGGAGG + Intronic
1062747391 9:138222414-138222436 TATGTAACTTAGGTGTGGAGTGG - Intergenic
1203531284 Un_GL000213v1:144861-144883 TATTTTTCTGAGTTGTGGGGTGG + Intergenic
1203354182 Un_KI270442v1:116163-116185 AATTTGGAATAGGTGTGGTGTGG - Intergenic
1185752370 X:2623404-2623426 GATTTGGCTTTGGTTTGGGTGGG - Intergenic
1186594480 X:10965986-10966008 TGTTTGGTTTTGTTGTGGGGTGG + Intergenic
1186736804 X:12474025-12474047 AATTTGGAATAGGTGTGGTGTGG - Intronic
1188909098 X:35823588-35823610 CATTTGTCTTAGGTGAGGAGAGG - Intergenic
1189062732 X:37771306-37771328 ATTTTGGCATAGGTGTGGTGTGG - Intronic
1189116367 X:38347141-38347163 AATTTGGCTTAGGTGTTTGAAGG - Intronic
1191827501 X:65381163-65381185 ATTTTGGATTAGGTGTGGTGTGG - Intronic
1192007899 X:67236787-67236809 GTTTTGGAATAGGTGTGGGGTGG - Intergenic
1192268648 X:69557745-69557767 AATTTGGCTTTGCAGTGGGGAGG - Intergenic
1195967245 X:110439788-110439810 TATCTGACTCAGGTGTGGGCAGG - Intronic
1198066334 X:133100146-133100168 CATTTGGCTGAAGTTTGGGGTGG + Intergenic
1199515863 X:148674860-148674882 TATTTGACTTGGGTGTGGGGAGG + Intronic
1201410446 Y:13693906-13693928 ATTTTGGATTAGGTGTGGTGTGG - Intergenic