ID: 966825500

View in Genome Browser
Species Human (GRCh38)
Location 3:183961719-183961741
Sequence TTAGTTCAGTAGTTCTCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 258}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966825500 Original CRISPR TTAGTTCAGTAGTTCTCTAC AGG Intronic
901102203 1:6727630-6727652 TTAATTCAGTGGCTCTCCACTGG + Intergenic
904229114 1:29052352-29052374 TTAGGGCAGTGGTTCTCAACTGG - Intronic
906174966 1:43763151-43763173 TTAATTAACTTGTTCTCTACTGG - Intronic
907087590 1:51690945-51690967 TTACTTCAGTAATACTCTACAGG - Intronic
908661259 1:66437944-66437966 TTAGGGCAGTGGTTCTCAACTGG + Intergenic
909552688 1:76916552-76916574 ATAATTCATTAGTTTTCTACTGG - Intronic
909772454 1:79440982-79441004 TTAGTCCAGTGATTCTCAACTGG + Intergenic
910024060 1:82627863-82627885 TTAGTTCAATACTCTTCTACAGG + Intergenic
911321049 1:96414574-96414596 TTAGTTCCCTGTTTCTCTACTGG - Intergenic
911577038 1:99590301-99590323 TTAGAGCAGTAGTTCTCAGCTGG + Intergenic
911695075 1:100881756-100881778 TTAATTCATTAGTTCTTTATAGG + Intronic
914677807 1:149917547-149917569 TTATTTCAGTTGTGCTCTTCAGG - Intronic
916000139 1:160607577-160607599 CTAGATCAGTGGTTCTCAACTGG + Intergenic
916583609 1:166130449-166130471 TTAATGCAGTGGTTCTCAACTGG + Intronic
918160510 1:181894626-181894648 AGAGTTCGGTAGGTCTCTACAGG - Intergenic
918235329 1:182574729-182574751 TTAAGGCAGTAGTTCTCAACTGG - Exonic
918446953 1:184626153-184626175 TTAGTTCAGTTGTGCTTTGCTGG - Exonic
918643921 1:186880432-186880454 TTAGTGCAGTGGTTCTAAACTGG + Intronic
919707784 1:200695240-200695262 TTAACTTAGTAGTTCTCAACTGG + Intergenic
1065181658 10:23132186-23132208 TTAGCTCAGGAGTTCTCACCTGG + Intergenic
1066151358 10:32622770-32622792 TTAACACAGTAGTTCTCAACTGG - Intronic
1067958942 10:50825846-50825868 TTAGGCCAGTGGTTCTCAACTGG + Intronic
1068228603 10:54139699-54139721 CTAGTTCAGAAGTTATCTAAAGG + Intronic
1069384958 10:67875816-67875838 CTAGATCAGTGGTTCTCAACTGG - Intergenic
1070371879 10:75790311-75790333 CTAGATCAGTAGTTCTCAACTGG - Intronic
1070396821 10:76018385-76018407 TTAGATCAGTGGTTCTCAAGTGG - Intronic
1071396707 10:85230932-85230954 TAACTTCAGGAGATCTCTACAGG + Intergenic
1072342145 10:94462495-94462517 TTAGATCAGTAATTCTCAACTGG - Intronic
1072442564 10:95469969-95469991 GTAGTTCAGTGGTTCTCGACAGG - Intronic
1073415131 10:103374774-103374796 TTATTGCAGTGGTTCTCAACTGG + Intronic
1073422049 10:103432381-103432403 TTAGACCAGAAGTTCTCTAGTGG - Intronic
1073605430 10:104890886-104890908 CTAAATCAGTAGTTCTCAACTGG - Intronic
1075418758 10:122285500-122285522 ATAGCCCAGTAGTTCTCAACAGG + Intronic
1078287691 11:9974444-9974466 TTAGAGCAGTGGTTCTCAACAGG - Intronic
1078513133 11:12000841-12000863 ACAGTGCAGTAGTTCTCAACTGG - Intronic
1078570015 11:12449626-12449648 CTAGATCAGTAGTTCTCCATGGG + Intronic
1078835635 11:15026695-15026717 TTAGATCAGCAGTGCCCTACCGG + Intronic
1079363372 11:19788317-19788339 TTACTACAGTGGTTCTCAACTGG - Intronic
1079372841 11:19866379-19866401 TTTGATCAGTAGTTCTCCACTGG - Intronic
1079606945 11:22381701-22381723 TTATTTCTGTATTTATCTACAGG + Intergenic
1085518788 11:77126308-77126330 TTTATTCAGTAGATCTGTACGGG + Intergenic
1086496755 11:87411955-87411977 TTAGGGCAGTAGTTCTCAACTGG - Intergenic
1086507029 11:87515837-87515859 TTAATTCAGTAGTTCTCACTAGG - Intergenic
1087802316 11:102517662-102517684 TTAGCTCAGTGGTTCTCAACTGG + Intergenic
1088196761 11:107282373-107282395 TTAATCCAGTTGTTCACTACAGG + Intergenic
1090991286 11:131819191-131819213 CTAGTTCAAAACTTCTCTACTGG + Intronic
1091181586 11:133609365-133609387 TTAGTTTAGTAGTTCTCACTTGG + Intergenic
1093537683 12:20242043-20242065 TTAGTTCAGTGGCTCTCTCAAGG + Intergenic
1093797645 12:23332317-23332339 TTAATGCAGTAGTTCATTACAGG - Intergenic
1094305316 12:29012775-29012797 TTAGTTCTTTAGTTCACTGCTGG + Intergenic
1096369725 12:51058877-51058899 TTAGACCAGTACTTCTCAACGGG - Intronic
1098049723 12:66440861-66440883 TTTATTCAGTAGTTCTCAACTGG - Intronic
1098099231 12:66996108-66996130 GTAGATCAGTAGTTGTCTAGGGG + Intergenic
1098494083 12:71114683-71114705 TTAGAACAGTTGTTCTTTACTGG - Intronic
1098696600 12:73565460-73565482 TTAGTTTTGTTTTTCTCTACTGG - Intergenic
1099813869 12:87620498-87620520 TATGTTCAGTAGTTCTCCAAAGG + Intergenic
1100277295 12:93082714-93082736 ATAGTTCTGTGGTTCTCCACTGG - Intergenic
1101347316 12:103898317-103898339 TTAGAGCAGTAGTTCTTAACAGG + Intergenic
1101633420 12:106517308-106517330 CTAGTTCAGTGGTTCTAAACTGG - Intronic
1102545580 12:113652678-113652700 TTAGATCAGTGGTTCTCAACTGG - Intergenic
1102706720 12:114887521-114887543 TTAGACCAGTGGTTCTCAACTGG + Intergenic
1102897437 12:116609931-116609953 TTAGAGCAGTGGTTCTCAACAGG - Intergenic
1103033467 12:117637238-117637260 TTGTTCCAGTAGTTCTCAACTGG + Intronic
1103143940 12:118577592-118577614 TTAGACCAGTATTTCTCAACTGG + Intergenic
1104617674 12:130284033-130284055 TTATGTCAGTGGTTCTCCACTGG - Intergenic
1105467414 13:20658804-20658826 TTACTTCAAGAGTTCTCAACTGG - Intronic
1107540555 13:41385307-41385329 TTAGTTCATTATTTCTCCACTGG + Intergenic
1108167045 13:47704291-47704313 TTACCTCAATAGTACTCTACAGG + Intergenic
1109350737 13:61177972-61177994 TTAGGGCAGTGGTTCTCAACTGG + Intergenic
1109482803 13:62978213-62978235 TTAGTTCAGTGATTCTTTAAGGG - Intergenic
1109817814 13:67609588-67609610 TAATATCAGTAGTTCTCAACTGG - Intergenic
1110237765 13:73234308-73234330 TTAGGCCAGTAGTTCTCAACAGG + Intergenic
1110273315 13:73615727-73615749 TGAGTTCAGGAGTTCACGACTGG - Intergenic
1110462689 13:75763116-75763138 TTAGATCAGTGGTTCTCAACTGG + Intronic
1112294170 13:98172026-98172048 TCAGTGCAGCAGTTCTCTTCTGG + Intronic
1114999328 14:28402086-28402108 TTATATCAGTAGTTCTCAGCTGG + Intergenic
1115177519 14:30580913-30580935 TAAGATCAGTAGTTCTCAACTGG - Intronic
1115855563 14:37626132-37626154 TTAGGTCAGTGGTTCTCAATTGG - Intronic
1115962418 14:38850425-38850447 TTTGTTCAGTATTTGTCTACTGG - Intergenic
1116134231 14:40900361-40900383 TTACTCCAGTCATTCTCTACTGG - Intergenic
1116572759 14:46538641-46538663 TTACTCCAGTGGTTCTCAACAGG - Intergenic
1117854915 14:60019188-60019210 CTGGTACAGTAGTTGTCTACTGG - Exonic
1118108824 14:62693276-62693298 GTAGATCAGTAGTTCTCAACTGG - Intergenic
1119268713 14:73281977-73281999 TTAGTGTAGTGGTTCTCAACTGG - Intronic
1120810107 14:88793866-88793888 TTATTACAGGAGTTTTCTACAGG - Intergenic
1121018863 14:90566777-90566799 TTAGCTAAGGAGTTCTCTAAGGG + Intronic
1121291634 14:92780384-92780406 TTAGCTCAGTGGTTCTCAACTGG + Intergenic
1124366526 15:29075550-29075572 TTAGAACAGTGGTTCTCAACTGG - Intronic
1125895034 15:43294696-43294718 TTATCTCAGTGGTTCTCAACGGG + Intronic
1127527699 15:59810156-59810178 TTAATGCATTAGTTCTCAACTGG + Intergenic
1129033207 15:72633069-72633091 TTAGGTCAGCAGTTCTCAACTGG - Intergenic
1129216677 15:74104161-74104183 TTAGGTCAGCAGTTCTCAACTGG + Intronic
1129407997 15:75331924-75331946 TTAGGTCAGCAGTTCTCAACTGG - Intergenic
1129471161 15:75754703-75754725 TTAGGTCAGCAGTTCTCAACTGG - Intergenic
1129733843 15:77948474-77948496 TTAGGTCAGCAGTTCTCAACTGG + Intergenic
1129841741 15:78747529-78747551 TTAGGTCAGCAGTTCTCAACTGG - Intergenic
1130848869 15:87774074-87774096 CTACTTCAGTACTTCTCAACTGG - Intergenic
1131548545 15:93336360-93336382 TTAGATCAGTGGCTCTCAACTGG + Intergenic
1132277447 15:100581420-100581442 TTAGCTCAGTGGTTCTCAACTGG - Intronic
1133144290 16:3772391-3772413 TCAGTGCAGTGGTTCTATACTGG + Intronic
1134135398 16:11673662-11673684 CTTGTTCAGTGGTTCTCAACTGG - Intronic
1134145499 16:11757520-11757542 TTAGCACAGTGGTTCTCAACTGG - Intronic
1134360353 16:13525201-13525223 TTAGCTCAGTGGTTCTCAAAGGG - Intergenic
1135028120 16:19014364-19014386 TTAGATCAGTGGTTCTCAAGTGG - Intronic
1135187166 16:20325016-20325038 TTAGATCAGTGGTTCTCAACTGG - Intronic
1135687486 16:24509581-24509603 TTAGTTCAGTTTTTCTGTGCTGG + Intergenic
1137595047 16:49717927-49717949 GTAGTCCAGTAGTTCAGTACTGG - Intronic
1139646170 16:68332394-68332416 TTAGAGCAGTGGTTCTCAACAGG - Intronic
1140304610 16:73791312-73791334 ATAGATCAGTAGTTCTCAAACGG + Intergenic
1141065244 16:80908749-80908771 ATAGCTCAGTTGTTCTCAACAGG - Intergenic
1141737113 16:85861121-85861143 CTAATTCAGTAGTTCTCAACAGG + Intergenic
1143547107 17:7603969-7603991 TTGTTTCAGTAGTTCTCCAAAGG + Intronic
1146239796 17:31209200-31209222 GTAATACAGTAGTTCTCAACTGG - Intronic
1147010801 17:37445797-37445819 GTAGATCAGTAATTCTCTATTGG + Intronic
1148179610 17:45594729-45594751 TTAGTCCCGTGGTTCTCAACTGG - Intergenic
1148269296 17:46251169-46251191 TTAGTCCCGTGGTTCTCAACTGG + Intergenic
1148541893 17:48487577-48487599 CTAAGTCAGTAGTTCTCAACAGG - Intergenic
1151313542 17:73308818-73308840 TGAGTTCAGGAGTTCGCGACCGG + Intronic
1151327592 17:73388676-73388698 TTAGTACAGTGCTTCTCAACTGG - Intronic
1155969933 18:32073305-32073327 TTAGGCCAGTACTTCTCAACTGG + Intergenic
1156474237 18:37395531-37395553 TGAGATCAGTAGTTCTCTCTGGG + Intronic
1157367830 18:47082391-47082413 TTAGTCCAGTGGTCCTCAACTGG - Intronic
1157848419 18:51025697-51025719 TTTTATCAGTATTTCTCTACTGG - Intronic
1159892550 18:73966266-73966288 TTAAGGCAGTAGTTCTCAACTGG - Intergenic
1161481955 19:4515580-4515602 TTAATTCAGTAGTTTTCAACTGG + Intronic
1166175524 19:41066263-41066285 TTAGTTCAGTGTTTCTCAAAAGG + Intergenic
1166842830 19:45709205-45709227 TTTTTTCAGTTGTTCTCAACAGG + Intergenic
1167854657 19:52227770-52227792 CTAGAGCAGTAGTTCTCAACTGG - Exonic
1168358963 19:55722102-55722124 CTAGCTCAGTAGTTCTCAATGGG - Intronic
925332316 2:3068125-3068147 TTAATCCAGTGGTTCTCAACTGG - Intergenic
926183530 2:10668329-10668351 TTAATTCAAAAGTTCTCCACAGG + Intronic
926974303 2:18497772-18497794 TTAAAGCAGTAGTTCTCAACAGG - Intergenic
927872766 2:26634023-26634045 CTAGCTTAGTAGTTCTCAACGGG + Intronic
928421547 2:31140795-31140817 CTAGTTCTGTAGGTCTCTCCAGG + Intronic
928424184 2:31164512-31164534 TTAGCTTAGCAGTTCTCCACAGG + Intergenic
929370557 2:41219235-41219257 TTAATGCAGTGGTTCTCAACTGG - Intergenic
929698657 2:44142304-44142326 TTAGAGCAGTAGCTCTCAACTGG + Intergenic
930533483 2:52618603-52618625 TTAGTTCATGAATTCTCTGCTGG - Intergenic
931607581 2:64067456-64067478 TTAGATCAGAGGTTCTCAACTGG + Intergenic
931772923 2:65514604-65514626 TTAGTTCAGTAGGATTTTACTGG + Intergenic
932021465 2:68091618-68091640 TTTGATCAGTGGTTCTCAACTGG - Intronic
932254805 2:70275354-70275376 TTAGTTCAGTAATTCTTAACTGG + Intronic
932399668 2:71471309-71471331 TTAATACAGTAGTTCTCAACTGG + Intronic
933406118 2:81862051-81862073 TTAGTTCAGCAGTTTTCCACTGG + Intergenic
933744368 2:85560075-85560097 TTAGCCCAGTAGTTCTCAACTGG - Intronic
933804247 2:85986802-85986824 TGAGTTCAGGAGTTCGCGACCGG + Intergenic
937083633 2:119157280-119157302 TCAGTTCTTTAGTTCTCTCCAGG - Intronic
939267788 2:139896311-139896333 TTGTTTCAGTATTTCTTTACAGG + Intergenic
939328445 2:140725930-140725952 TAAATTCAGTAGTTCTCAAATGG + Intronic
939896124 2:147793181-147793203 TTAGCTCAATGGTTCTCAACTGG - Intergenic
940584096 2:155622202-155622224 GTAGTTCAGTGGTTCTCAATAGG + Intergenic
942301647 2:174568406-174568428 TTAGTTCAATAGCTCTTTAAAGG - Intronic
944514478 2:200498649-200498671 CTAGTGCAGTGGTTCTCAACTGG - Intronic
945071985 2:206000298-206000320 TTAGTTCAGAAGGTCGCTATGGG - Exonic
945259909 2:207833744-207833766 TTAGGTCAGTGGTTCTCAACAGG - Intronic
946880915 2:224176322-224176344 TTAGCTCAGTGGATCTCAACTGG - Intergenic
947185315 2:227449763-227449785 TTAGGTTAGTAGTTCTCAACTGG - Intergenic
947279627 2:228436220-228436242 CTAGTTAAACAGTTCTCTACTGG + Intergenic
1169033172 20:2429166-2429188 TTAGTTCAGTAGGTCATTATTGG - Intronic
1169161267 20:3380611-3380633 CTAGTGCAGTAGTTCCCAACTGG - Intronic
1169282948 20:4282477-4282499 TTAATTAACCAGTTCTCTACAGG + Intergenic
1170849489 20:19991571-19991593 TTACATCAGTGGTTCTCAACTGG - Intronic
1171328904 20:24320001-24320023 TGAGCTCAGTAGATCTCTGCCGG + Intergenic
1172879477 20:38190120-38190142 TTAAATCAGTAGTTCTCTAGGGG - Intergenic
1173217420 20:41098527-41098549 TTTGCTCAGTAGCTCTGTACAGG + Intronic
1173906125 20:46631116-46631138 TTAATCCAGTGGTTCTCGACAGG + Intronic
1174203077 20:48820614-48820636 TTAGCCCAGTGGTTCTCAACTGG + Intronic
1174204806 20:48830423-48830445 TTACATCAGTGGTTCTCAACAGG - Intergenic
1174622528 20:51887034-51887056 TGAGATCAGTGGTTCTCAACTGG + Intergenic
1175417238 20:58809972-58809994 TTATCTCAGTGGTTCTCAACTGG - Intergenic
1175590333 20:60184848-60184870 CTATTCCAGTAGTTCTCAACCGG + Intergenic
1175792649 20:61751347-61751369 GTAGTTCAGTGGTTCTCAAAAGG - Intronic
1177888303 21:26773368-26773390 CTAATTCAGTGGTTCTCAACTGG - Intergenic
1178269404 21:31176012-31176034 TTAGGCCAGTAGTTCTCAACTGG + Intronic
1178397637 21:32256453-32256475 TTTGTTCAATGGCTCTCTACCGG + Intergenic
1178761616 21:35408273-35408295 TTAGTCCAGGACTTCTCAACAGG - Intronic
1179389481 21:40974401-40974423 TTAAGACAGTAGTTCTCAACAGG - Intergenic
1179451480 21:41471342-41471364 TTAGGCCAGTAGTTCTCAACTGG + Intronic
1183193532 22:36337125-36337147 TTAGTCCAGTAGTTCTTAACTGG + Intronic
1184665997 22:45989399-45989421 TTAGACCAGTGGTTCTCAACTGG - Intergenic
951551278 3:23877615-23877637 TTAGAGCAGTGGTTCTCAACTGG - Intronic
951685676 3:25341612-25341634 TTAAATCAGTAGTTCTCAACTGG + Intronic
954237510 3:49268049-49268071 TTAGTTCACTGGTTTACTACTGG - Intergenic
954422928 3:50428090-50428112 TTAGGCCAGTGGTTCTCAACTGG + Intronic
955376862 3:58404538-58404560 ATAGGTCAGTAGCTCTCAACTGG - Intronic
955761770 3:62292617-62292639 TTAGAGCAGTAGTTCTCAATTGG + Intronic
955804817 3:62722988-62723010 CTAGATCAGTGGTTCTCAACTGG - Intronic
955867700 3:63402360-63402382 TTAGAGCAGTGGTTCTCAACTGG - Intronic
955972788 3:64452323-64452345 TCAGTCCAGTGGATCTCTACAGG - Intergenic
956452718 3:69390362-69390384 CTAGTTCAATGGTTCTCAACCGG + Intronic
956681535 3:71785624-71785646 TTTGTTCAGCAGGTCTATACTGG + Intergenic
956757831 3:72406678-72406700 TAAGGCAAGTAGTTCTCTACTGG - Intronic
956763518 3:72464328-72464350 CTAGTTTCATAGTTCTCTACTGG + Intergenic
958898262 3:99854700-99854722 ATAGATCAGTAGTTCTCAACTGG - Intronic
959245826 3:103866296-103866318 TTAGATCAGCAGTTCTCATCTGG - Intergenic
961642154 3:128371500-128371522 TTAGACCAGTGGTTCTCAACTGG - Intronic
961735129 3:128996696-128996718 TCAGCTGAGTAGTTCTCTGCTGG + Intronic
962034136 3:131632915-131632937 CTAGGTCAGTGGTTCTCCACTGG - Intronic
963574497 3:147042859-147042881 TTAATTCAGTGGTTCTCAATAGG - Intergenic
963756769 3:149242610-149242632 TTAGTACAGTGGTTCTCTACAGG + Intergenic
964265098 3:154887270-154887292 TTGGTTCCGTAGTTATCTAAAGG - Intergenic
966825500 3:183961719-183961741 TTAGTTCAGTAGTTCTCTACAGG + Intronic
967211314 3:187172442-187172464 TTAGCTCCATAGTTCTTTACTGG + Intronic
967671618 3:192242457-192242479 CTACTTCAGTGGTTCTCAACTGG - Intronic
969538816 4:7773151-7773173 TAAATTCAGCAGTTCTCTAAGGG + Intronic
970681608 4:18514918-18514940 TTAGATCATTACTTCTCAACTGG + Intergenic
971219810 4:24694458-24694480 TTAACCCAGTAGTTCTCAACTGG - Intergenic
971723508 4:30277853-30277875 TTCATTCAGTGGTTCTCAACTGG - Intergenic
972256195 4:37358303-37358325 TTATTGCAGTAGCTCTCTAAAGG - Intronic
976485720 4:85601599-85601621 TTAATACAGTGGTTCTCAACTGG - Intronic
976984089 4:91270953-91270975 GAAGTGCAGGAGTTCTCTACTGG + Intronic
977007627 4:91590991-91591013 TTAGGGCAGTGGTTCTCAACTGG + Intronic
977184009 4:93914566-93914588 TTAGATCAGTGGTTTTCAACTGG - Intergenic
981150802 4:141377540-141377562 TTAGTTCAGTTATTCTTTACTGG + Intergenic
981945576 4:150339800-150339822 TTAATTAACTACTTCTCTACTGG + Intronic
983438168 4:167744006-167744028 TTATTTCAATATTTCTCTGCTGG - Intergenic
985936693 5:3102917-3102939 TTAGTTCATTAGTTCACAACAGG - Intergenic
986445037 5:7814300-7814322 TTAGTGCAGTGATTCTCAACTGG + Intronic
987150790 5:15037504-15037526 TTAATGCAGTAGTTCTCTAGGGG + Intergenic
988030363 5:25756087-25756109 CTAATTCAGAAGTTCTCTAAAGG - Intergenic
989183549 5:38601486-38601508 TCAGTTCAGGATTTCTCTCCTGG + Intronic
990166881 5:53004190-53004212 TTAGTGCAGTGGTGCTCAACTGG - Intronic
990858185 5:60295672-60295694 TTAGCTCAGTGGTTCTCAACTGG - Intronic
991196252 5:63935910-63935932 TTGGATCAGTGGTTCTCAACTGG - Intergenic
991682859 5:69155846-69155868 TTAATCAAGTAGTTCTCAACTGG - Intergenic
992007342 5:72490816-72490838 CAAGTTCAGTAGTTCTCAACTGG - Intronic
992974860 5:82104735-82104757 TTAAATCAGTAGGTCTCTAAAGG - Intronic
994067539 5:95559950-95559972 TTAGTTCAATAGTTTTGTAGTGG - Intronic
995732058 5:115256095-115256117 TGAGAACAGTGGTTCTCTACTGG + Intronic
996410573 5:123154610-123154632 TTAGCTCAGCAGTTCTATTCCGG - Intronic
996464762 5:123786876-123786898 TCAGTTCAGTAGTCCTGTCCTGG - Intergenic
997783126 5:136679854-136679876 TTAGAACAGTAGTTCTCAACTGG - Intergenic
997992243 5:138554282-138554304 TTAAGCCAGTAGTTCTCAACTGG + Intergenic
998880149 5:146637253-146637275 CTAGATCAGTGGTTCTCAACTGG + Intronic
998965920 5:147540086-147540108 TTAGTTGAGTAGTTCTCTCTTGG + Intergenic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
999813304 5:155149669-155149691 TCAGATCAGTGGCTCTCTACGGG + Intergenic
999840668 5:155422384-155422406 CTAGATCAGTTGTTCTCAACAGG - Intergenic
999930131 5:156422848-156422870 TTACATCAGTGGTTCTCAACTGG - Intronic
1000600580 5:163269745-163269767 TTAGTTCTGCAGTTCTCAAAAGG - Intergenic
1001435984 5:171699744-171699766 TTAGAACAGTTGTTCTCAACTGG - Intergenic
1002958936 6:1896302-1896324 TTAGCTCAGTGCTTCTCTAAAGG - Intronic
1003034106 6:2628219-2628241 TTAAGTCAGTGGTTCTCAACTGG + Intronic
1005278058 6:24241213-24241235 TTTACTCTGTAGTTCTCTACAGG + Intronic
1007119424 6:39367833-39367855 TTGGTTCAATGGTTCTCAACTGG + Intronic
1008434106 6:51455023-51455045 CTAGATCACTAGTTCTTTACTGG + Intergenic
1011552817 6:88545492-88545514 CTAGCTCAGTGGTTCTCAACAGG + Intergenic
1011574753 6:88783866-88783888 TTAGATCAGTGATTCTCAACTGG - Intronic
1012272181 6:97226964-97226986 CTAGTTCAGTAGTTCTCAACTGG - Intronic
1016673083 6:146731176-146731198 GTAGGTGAGTAGTTCTCAACTGG - Intronic
1016812935 6:148278480-148278502 TTAATTCAGTATTTCTTTCCAGG - Intronic
1017759290 6:157555869-157555891 TTACAGCAGTGGTTCTCTACTGG - Intronic
1020401800 7:7787084-7787106 TAAGTTCAGCAGTTTTCTAGGGG - Intronic
1020555171 7:9662012-9662034 CTAGTTCACTAGTTCACTATTGG - Intergenic
1021248602 7:18295720-18295742 GTAGACCAGTAGTTCTCAACCGG + Intronic
1021669575 7:23021694-23021716 TTAGTTCAGTGGATTTTTACAGG + Intergenic
1022331748 7:29385717-29385739 TTAGGCCAGTGGTTCTCAACTGG - Intronic
1024924551 7:54599329-54599351 TTAGAGCAGTGGTTCTCAACTGG + Intergenic
1026065972 7:67073175-67073197 TTAAATCAGTGGTTCTCAACTGG + Intronic
1026427279 7:70308695-70308717 TTAGAACAGTAGTTCTCAACTGG + Intronic
1027883558 7:83873867-83873889 TTTTTTCAATAGTTCTCCACGGG - Intergenic
1030266008 7:107622642-107622664 GTAAATCAGTAGTTCTCAACAGG + Exonic
1030351958 7:108499713-108499735 TTAGGTTAGTAATTCTCCACTGG - Intronic
1031084895 7:117292628-117292650 TTACTTCAGGACTTCTCTAGAGG + Intronic
1032744023 7:134767776-134767798 TTAGAACAGCAGTTCTCTAGAGG + Intronic
1036188453 8:6646816-6646838 TTAGGTCAATGGTTCTCAACTGG - Intergenic
1036616101 8:10388947-10388969 CTAGTTCAGTGATTCTCAACTGG - Intronic
1036616314 8:10390380-10390402 CTAGGTCAGTGGTTCTCAACTGG - Intronic
1037552807 8:19991615-19991637 TGAGGTCAGTACTTCTCTGCAGG - Intergenic
1037853224 8:22349957-22349979 TTAGTGAAGTGGTTCTCAACTGG + Intronic
1038159008 8:25019019-25019041 TTAGCCCAGTGGTTCTCAACAGG - Intergenic
1038624412 8:29177043-29177065 TTAGACCAGTGGTTCTCAACTGG + Intronic
1041340038 8:56835286-56835308 TTAGTTCAGGAGTTCAAGACTGG + Intergenic
1041653858 8:60329099-60329121 AGAGTTCAGTTGTTCTCTTCTGG + Intergenic
1042349213 8:67760245-67760267 TTAGTTCAGTGGTTCTCAGATGG + Intergenic
1045496986 8:102717349-102717371 TTAAACCAGTAGTTCTCGACTGG - Intergenic
1045908068 8:107372290-107372312 TTATATCAGTAGTTCTCAGCTGG - Intronic
1047126400 8:121966227-121966249 TTAGGTCACTAGGTCTCAACTGG + Intergenic
1049910148 9:258017-258039 TTAGTTCAGTTGTCCCCCACAGG + Intronic
1049928713 9:434999-435021 TTAGAGCAGTGGTTCTCAACTGG + Intronic
1052468308 9:28858390-28858412 TTAGATCAGTAGTTCTACATTGG - Intergenic
1053052477 9:34973120-34973142 CTAGCTCAGAGGTTCTCTACCGG - Intronic
1053192358 9:36083124-36083146 ATAGTCCAGTGGTTCTCCACAGG - Intronic
1054778685 9:69146655-69146677 TTAGGTCAGTGGTTGTCAACGGG + Intronic
1054885646 9:70195384-70195406 TTACTTCAGTAGCTCTATCCTGG + Intronic
1054897534 9:70330366-70330388 TTAGACCAGTGGTTCTCAACTGG - Intronic
1055407494 9:75989814-75989836 TTATTTCTGTAGTTTTCTATTGG + Intronic
1056370316 9:85947555-85947577 TTAGATTAGTGGTTCTCAACTGG + Intronic
1057426390 9:94953541-94953563 TTATTTCAGTTATTCTCTGCAGG + Intronic
1058451733 9:105103252-105103274 ATAGTTCATGAGTTCTCTAAGGG - Intergenic
1059759149 9:117321927-117321949 TTACAGCAGTAGTTCTCAACAGG - Intronic
1059795983 9:117697279-117697301 TTAGAATAGTAGTTCTCAACTGG - Intergenic
1060955340 9:127634881-127634903 CTAGTCCAGTGGTTCTCAACAGG - Intronic
1061474708 9:130856857-130856879 TTATTTCAGTAGTCCCCTGCTGG + Intronic
1061641326 9:131959014-131959036 TTACTTCAGTAGTAATGTACAGG - Intronic
1186601284 X:11040495-11040517 CTAGCTCAGTGGTTCTCAACTGG + Intergenic
1186624637 X:11279935-11279957 CTAGCTTAGTAGTCCTCTACTGG + Intronic
1186762935 X:12742149-12742171 TTAGCCCAGTGGTTCTCAACTGG + Intergenic
1186821993 X:13298330-13298352 ATAGATCAGTGGTTCTCAACTGG - Intergenic
1187007168 X:15243828-15243850 CTAGTTCAGTGGTTCTCCACTGG - Intronic
1187040879 X:15594500-15594522 TTATGTCAGTGGTTCTCAACTGG - Intronic
1187978472 X:24729386-24729408 TTAGCTCAGTGGTTCTCAACTGG - Intronic
1188127604 X:26389457-26389479 TTGGTTCTCTAGTCCTCTACAGG + Intergenic
1193631906 X:83899684-83899706 TTAGTGCAGTAGTTTTGTGCTGG - Intergenic
1195641666 X:107182374-107182396 CTAGTTCAGTAGTTCTCAGCTGG - Intronic
1196868294 X:120088785-120088807 TCAGTTCAGTAATTCTCAACAGG - Intergenic
1197111885 X:122784847-122784869 TTTGTTTAGGAGTTCTGTACTGG - Intergenic
1197858488 X:130945089-130945111 TAAGTTCAGCAGTTCCCTAAAGG + Intergenic
1197956543 X:131955500-131955522 TTAGTTTAGTAGTCAGCTACTGG - Intergenic
1198675112 X:139123072-139123094 TTAGGGCAGTGGTTCTCAACGGG - Intronic
1199111466 X:143940451-143940473 TGAGTTCAGTAATTTTCTTCAGG + Intergenic