ID: 966826720

View in Genome Browser
Species Human (GRCh38)
Location 3:183971054-183971076
Sequence GTCTCAGAGGGCCTCCTATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966826720_966826725 -4 Left 966826720 3:183971054-183971076 CCCTATAGGAGGCCCTCTGAGAC 0: 1
1: 0
2: 1
3: 7
4: 114
Right 966826725 3:183971073-183971095 AGACTAATCTTGTGCTACCTGGG 0: 1
1: 0
2: 0
3: 4
4: 82
966826720_966826724 -5 Left 966826720 3:183971054-183971076 CCCTATAGGAGGCCCTCTGAGAC 0: 1
1: 0
2: 1
3: 7
4: 114
Right 966826724 3:183971072-183971094 GAGACTAATCTTGTGCTACCTGG 0: 1
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966826720 Original CRISPR GTCTCAGAGGGCCTCCTATA GGG (reversed) Intronic
901721914 1:11205640-11205662 GCCTCAGAGTGCCTCATCTAAGG + Intronic
902686644 1:18081709-18081731 GTCTCAGCAGGCCTCAGATAGGG + Intergenic
906031445 1:42723546-42723568 GTCTCAGCTGGCCTCCTAAAGGG - Intergenic
909063882 1:70909494-70909516 GTCTCAGAAGGCCCCATAAAAGG + Intronic
910590915 1:88927505-88927527 GACTCTGAGGGCTTCCTGTAGGG - Intergenic
915301717 1:154955461-154955483 GTTTCAGAGTGTCTCCTATTTGG - Intronic
921934712 1:220786322-220786344 GTCTGAGAGTGCCTTCTACACGG - Intergenic
1067090621 10:43264364-43264386 GTGTCAGAGGCCCTCCCCTATGG - Intronic
1067090632 10:43264407-43264429 GTATCAGAGGCCCTCCTCTATGG + Intronic
1067734440 10:48838252-48838274 GTCTCATAGGGCAGCCTTTAGGG - Intronic
1069714313 10:70510691-70510713 GTCTCAGAAGGCTCCCTAGAGGG + Intronic
1070121487 10:73581554-73581576 AATTCAGAGGGCCTCCTTTAAGG - Intronic
1074684964 10:115952843-115952865 TTCTCAGAGGGCTTTCCATATGG + Intergenic
1078061596 11:8049334-8049356 GTCTAGGATGGCCTCCAATACGG - Intronic
1079887031 11:26002300-26002322 GACTCTGAGGGCTTCCTGTAGGG - Intergenic
1079933857 11:26594726-26594748 GACTCTGAGGGCTTCCTGTAGGG + Intronic
1082130358 11:48481329-48481351 TTCTCTAAGGGCCTCTTATAAGG - Intergenic
1082246756 11:49932328-49932350 TTCTCTAAGGGCCTCTTATAAGG + Intergenic
1086554973 11:88098675-88098697 GTCTCAGAGGTGCTTCTGTAAGG - Intergenic
1092469569 12:8765790-8765812 GACTCTGAGGGCTTCCTGTAGGG + Intronic
1095361716 12:41349851-41349873 GTCAAAAAGGGCCTCATATAGGG + Intronic
1096352190 12:50909614-50909636 GACTCTGAGGGCTTCCTGTAGGG + Intergenic
1097149777 12:56968087-56968109 GACTCTGAGGGCTTCCTGTAGGG + Intergenic
1097377388 12:58856681-58856703 GACTCTGAGGGCTTCCTGTAAGG + Intergenic
1102250571 12:111384216-111384238 GTCTCAAAGGGCTTCTTCTACGG - Intergenic
1104720602 12:131043204-131043226 TTCTCAGATGGCCTCCTGTCCGG + Intronic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1108343183 13:49517646-49517668 GTCTCAAAGGGCCCCCTAGTGGG + Intronic
1108479332 13:50852205-50852227 ACCTCAGAGGGCCTTCTATAAGG + Intergenic
1108876564 13:55056687-55056709 GACTCTGAGGGCTTCCTGTAGGG - Intergenic
1112720342 13:102236903-102236925 CTCTCAGAGGGCCTCCCAGCAGG + Intronic
1113160094 13:107370222-107370244 GAATCAGAGGGCTTCCTATCCGG + Intronic
1113224471 13:108144322-108144344 GTCTCCCAGTGCCTCCTGTAGGG + Intergenic
1114384206 14:22239314-22239336 GACTCTGAGGGCTTCCTGTAGGG - Intergenic
1119800744 14:77442948-77442970 ATCTCTGAGGGCGTCCTTTAGGG - Intronic
1123061856 14:105598092-105598114 GTCCCAGAGGGCCCCGGATAGGG - Intergenic
1123086596 14:105719823-105719845 GTCCCAGAGGGCCCCGGATAGGG - Intergenic
1123143712 14:106108198-106108220 GTCTCTGAGGATCTCCTGTAAGG - Intergenic
1124208422 15:27742800-27742822 TTCTCAGAGGGCCTTATGTATGG - Intergenic
1125571248 15:40720080-40720102 GTATCAGAGGCCCTGCTAAAGGG + Intronic
1126809643 15:52388565-52388587 GTTTCACAGGGTCTCCTTTAGGG - Intronic
1128362748 15:66973894-66973916 GACTCTGAGGGCTTCCTGTAGGG + Intergenic
1130718482 15:86362519-86362541 AGTTCAGAGGGCCTGCTATAGGG + Intronic
1136384337 16:29913648-29913670 TTCTCAGAGTGCATCCTCTAGGG - Intronic
1138116827 16:54367550-54367572 GTCACAGAGTGCCACCTAAATGG - Intergenic
1141876268 16:86826841-86826863 GTCTCAGAGTGTCTCCAATCAGG - Intergenic
1141919551 16:87126890-87126912 GGCGCAGAGGGCCACCTACAAGG - Intronic
1149274207 17:55015779-55015801 GACTCTGAGGGCTTCCTGTAGGG + Intronic
1153110678 18:1582732-1582754 TTCTCTGAGGTCCTCCTATGAGG + Intergenic
1153401428 18:4687646-4687668 GACTCTGAGGGCTTCCTATAGGG - Intergenic
1155779066 18:29808177-29808199 CTTTCAGAAGGCTTCCTATAAGG - Intergenic
1158517057 18:58139308-58139330 GTATCTGAGGGTCTCCTGTATGG - Intronic
1164057242 19:21632154-21632176 GACTCTGAGGGCTTCCTGTAGGG - Intergenic
1166941006 19:46365655-46365677 GTCTTAAAGGGCCTCCCATTAGG - Intronic
926001093 2:9333420-9333442 GTATAAGAAGGCCTCTTATAGGG + Intronic
928392648 2:30921169-30921191 GTCTCTGTGGGCCTCCGAGAGGG - Intronic
928395605 2:30941258-30941280 GTTACAGAGGGCCTCCTACCTGG + Intronic
928965294 2:36969510-36969532 CTCTCATAGTGCCTACTATATGG + Intronic
933899859 2:86841761-86841783 GTCTCTGAGGGCTTCCTTTGGGG - Intronic
935391407 2:102557099-102557121 GTCTCAGTAGGCCTCATATTTGG + Intergenic
935780700 2:106507464-106507486 GTCTCTGAGGGCTTCCTTTGGGG + Intergenic
935962820 2:108444155-108444177 GTCTCAGAAGACCACCTAAATGG - Intergenic
942573400 2:177337088-177337110 GTATAAGAGAACCTCCTATAAGG - Intronic
948666092 2:239535748-239535770 GTCCCTGAGGGTCTCCTAAATGG + Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1172180018 20:32997183-32997205 GTCTCAGAGGACCTCAGAAAGGG - Intronic
1173596965 20:44264648-44264670 GTCTCAGAGGACCTCCCAGGTGG + Intronic
1175537209 20:59722900-59722922 CTATCAGATGGACTCCTATATGG + Intronic
1176206864 20:63893904-63893926 GTCTCAGAGGGACTCACTTAAGG + Intergenic
1176890042 21:14304711-14304733 GACTCAAAGGGCCTATTATATGG + Intergenic
1177263618 21:18757562-18757584 GACTCTGAGGGCTTCCTGTAGGG + Intergenic
1177896142 21:26857676-26857698 GACTCTGAGGGCTTCCTGTAGGG - Intergenic
1178981708 21:37269950-37269972 GTATCAGAGGGCCTGCTGGAAGG - Intergenic
1179035313 21:37754239-37754261 GTCTCAGAAGCCCTCCTTTCTGG - Intronic
1183874159 22:40764683-40764705 GTCACAGAGGGCCTTCAACAAGG - Intergenic
1183983291 22:41555216-41555238 GCCTCAGAGGCCCTCCTATAGGG + Intergenic
951200799 3:19873808-19873830 GACTCTGAGGGCTTCCTGTAGGG + Intergenic
952922342 3:38294238-38294260 GACTCCGAGGGCTTCCTGTAGGG + Intronic
952963547 3:38607615-38607637 GTCACAGAGGGCCACCTCAAAGG - Intronic
955367966 3:58327649-58327671 ATCTCAGAGGGGCTCCTCTGAGG + Intergenic
958016371 3:87943610-87943632 GACTCTGAGGGCTTCCTATAGGG + Intergenic
961513326 3:127417886-127417908 GCCTCTGGGGGCCTCCTACATGG + Intergenic
961592612 3:127991944-127991966 GTCTCACAGGACCTGCAATAAGG + Intergenic
963187833 3:142438868-142438890 GACTCTGAGGGCTTCCTGTAGGG - Intronic
964953322 3:162323967-162323989 GACTCTGAGGGCTTCCTGTAGGG - Intergenic
966236281 3:177705329-177705351 TTCTCAGTGGGCCTCAGATAGGG - Intergenic
966353382 3:179055434-179055456 GACTCTGAGGGCTTCCTGTAGGG - Intronic
966826720 3:183971054-183971076 GTCTCAGAGGGCCTCCTATAGGG - Intronic
971618382 4:28823530-28823552 GTCTCAGAGTGCCGAGTATACGG + Intergenic
972584400 4:40423547-40423569 GTATCAGTGAGCCTCCTATCTGG - Exonic
975313932 4:72930924-72930946 GACTCTGAGGGCTTCCTGTAGGG + Intergenic
976189716 4:82476612-82476634 GACTCTGAGGGCTTCCTGTAGGG - Intergenic
978586917 4:110283586-110283608 GGCTCTGAGGGCTTCCTGTAGGG + Intergenic
978909449 4:114047421-114047443 GACTCTGAGGGCTTCCTGTAGGG - Intergenic
980446850 4:132921201-132921223 GTCTCACGGGGGATCCTATAAGG - Intergenic
981759058 4:148173536-148173558 CTCTCATAGAGCCTCCTCTAAGG + Intronic
984723637 4:183000000-183000022 GACTCTGAGGGCTTCCTATAGGG - Intergenic
987744570 5:21953128-21953150 CTCTCTGAGGGCCACCTATGAGG + Intronic
991764776 5:69963250-69963272 CTCTCTGAGGGCCACCTATGAGG + Intergenic
991782548 5:70154903-70154925 CTCTCTGAGGGCCACCTATGAGG - Intergenic
991844008 5:70838321-70838343 CTCTCTGAGGGCCACCTATGAGG + Intergenic
991874991 5:71155216-71155238 CTCTCTGAGGGCCACCTATGAGG - Intergenic
995904015 5:117101604-117101626 GTCTCTGAGAGCATCCTTTAAGG - Intergenic
1005323771 6:24680097-24680119 GACTCTGAGGGCTTCCTGTAGGG + Intronic
1006426504 6:33966622-33966644 TTCTCAGAGAGCCTTCTATGAGG - Intergenic
1008469360 6:51865940-51865962 GTCTGAGAGGCACTCCTCTAAGG - Intronic
1011189895 6:84717622-84717644 GACTCTGAGGGCTTCCTGTAGGG + Intronic
1013022126 6:106230956-106230978 GACTCTGAGGGCTTCCTGTAGGG - Intronic
1013543438 6:111133671-111133693 GACTCTGAGGGCTTCCTGTAGGG - Intronic
1016444826 6:144120709-144120731 GACTCTGAGGGCTTCCTGTAGGG + Intergenic
1016560654 6:145392281-145392303 GTCTCCGATGGCCTCCTCAAAGG + Intergenic
1026009573 7:66626408-66626430 GCCTCAAGGGGCCTCCTTTAGGG + Intergenic
1028538273 7:91913791-91913813 GAGTCAGAGGGCCTCCAAAAAGG + Intergenic
1030843602 7:114383470-114383492 GACTCTGAGGGCTTCCTGTAGGG + Intronic
1032280948 7:130500808-130500830 CTCTCAGAGGGCCGAGTATACGG - Exonic
1041663985 8:60424664-60424686 GACTCTGAGGGCTTCCTGTAGGG + Intergenic
1042817699 8:72895447-72895469 GTCTCCTAGAGCCTCCTAAAAGG + Intronic
1047443991 8:124903312-124903334 GACTCTGAGGGCTTCCTGTAGGG + Intergenic
1060489640 9:124073319-124073341 GGCACAGAGGGACTCCTACAAGG + Intergenic
1191119258 X:56886483-56886505 GTCTCAGAAGCCCTCCTAAAGGG - Intergenic
1193306604 X:79958730-79958752 GACTCTGAGGGCTTCCTGTAGGG - Intergenic
1198691974 X:139294304-139294326 GTTTCAGGGGGCCTTCTCTATGG + Intergenic
1200052175 X:153439746-153439768 GCCTCACAGGGTCTCCTGTAAGG - Intergenic