ID: 966828032

View in Genome Browser
Species Human (GRCh38)
Location 3:183981689-183981711
Sequence TTGTATGTGCATGTGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 1, 2: 0, 3: 46, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966828032_966828034 25 Left 966828032 3:183981689-183981711 CCTTCTACCACATGCACATACAA 0: 1
1: 1
2: 0
3: 46
4: 263
Right 966828034 3:183981737-183981759 CTGAGAAAATGCTTTGACCCAGG 0: 1
1: 0
2: 3
3: 14
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966828032 Original CRISPR TTGTATGTGCATGTGGTAGA AGG (reversed) Intronic
900010091 1:98835-98857 GTGTGTGTGCATGTGGTAGTGGG + Intergenic
900026202 1:275419-275441 GTGTGTGTGCATGTGGTAGTGGG + Intergenic
900035986 1:409272-409294 GTGTGTGTGCATGTGGTAGTGGG + Intergenic
900057610 1:645023-645045 GTGTGTGTGCATGTGGTAGTGGG + Intergenic
900075122 1:808362-808384 TTGCATGTGCATGTGGTATGTGG - Intergenic
900554252 1:3271876-3271898 TGGTGTGTGCAGGTGGTAGTGGG - Intronic
902595545 1:17507279-17507301 GTGTGTGTGCATGTGGTGGAAGG - Intergenic
902693822 1:18127001-18127023 TTGTATTTGCATGGGGTACGTGG - Intronic
902988229 1:20168765-20168787 ATGTATGTGCATGTGGGCGGAGG + Intronic
904339567 1:29826051-29826073 TTGTATGTGCATGTGTTTGCAGG - Intergenic
905492909 1:38359203-38359225 TTGTATGTGCCAGTGGCAGGAGG - Intergenic
906160879 1:43648302-43648324 TGGTATGTGCATGTGATAGGTGG - Intergenic
906210415 1:44009751-44009773 TTGTGTGTACACGTGGTAGGAGG + Intronic
906287603 1:44597908-44597930 TTGTATGTGAAGGAGGTAGACGG - Intronic
908799889 1:67868710-67868732 GTGTATGTGTATGGGGTAGATGG - Intergenic
911717829 1:101155085-101155107 TTATATGTGGATGAGGGAGAAGG + Intergenic
912552705 1:110494416-110494438 TTGGATGTGGCTGTGGCAGAAGG - Intergenic
913400821 1:118430752-118430774 TTGTATGTACATGTCTAAGAAGG + Intergenic
915060680 1:153181556-153181578 GTGTATGTGCATGGGGTTGTGGG - Intergenic
916559969 1:165926202-165926224 GTGTATGTGCATGTGTCAGGGGG + Intergenic
917820906 1:178763013-178763035 TTGTATTTGTATATGGTACAAGG + Intronic
918083236 1:181223381-181223403 GTGTATGCGCATGTGTTTGACGG + Intergenic
918441144 1:184568180-184568202 TTGTGTGTGTATGTGGTAAAAGG - Intronic
918553093 1:185766695-185766717 TTTTGTGTGTGTGTGGTAGAAGG + Intronic
919035750 1:192307080-192307102 TTGTATATGTATATGGTACAGGG + Intergenic
920194853 1:204220043-204220065 TTGTATGTGTCTGTGCTACAGGG + Exonic
920865920 1:209753563-209753585 TTGTGTGTGCATCTGGCAGGGGG - Intergenic
922258525 1:223914840-223914862 GTGTGTGTGCATGTGGTGGTGGG + Intergenic
922270962 1:224033261-224033283 TTGCATGTGCATGTGGTATGTGG - Intergenic
922999577 1:229995699-229995721 GTGTGTGTGCACATGGTAGAAGG + Intergenic
923659098 1:235943144-235943166 GTGTATGTGCATGTGTGTGATGG - Intergenic
924339719 1:243017602-243017624 GTGTGTGTGCATGTGGTAGTGGG + Intergenic
924447377 1:244145757-244145779 TTGTCTTTTCATGTGGTAGATGG - Intergenic
924601969 1:245498934-245498956 TTTTTTGTGCATGTGTTAGATGG + Intronic
924707588 1:246512008-246512030 TGGGATGTGTATTTGGTAGAAGG - Intergenic
1064300010 10:14114924-14114946 TTGTGAGTGGATGTGGGAGAAGG + Intronic
1064336664 10:14449068-14449090 ATGTATGTGCATGTTGGAGGTGG - Intronic
1064551430 10:16504957-16504979 TAGTATGTACATGTGGAAAATGG + Intronic
1065645959 10:27834243-27834265 TTATACGTGCATGTGGTCTAGGG + Intronic
1067304851 10:45053278-45053300 TTGTATATACATGAGGTAAAAGG + Intergenic
1069802833 10:71092942-71092964 ATGTCTGTGCATGTGCAAGAAGG + Intergenic
1070056913 10:72944197-72944219 ATGTTTGTGCATTTGGTACATGG - Intronic
1070334960 10:75447249-75447271 TTGTATGTTCTGGTGGTAGCTGG - Intronic
1071017042 10:81009774-81009796 TTGTAGATCCATGTGTTAGAGGG + Intergenic
1071718143 10:88117460-88117482 TGGTATGTGCATTTGGCTGAGGG + Intergenic
1072174111 10:92898851-92898873 TTGTCTGTCCATATTGTAGAGGG + Intronic
1072852181 10:98907570-98907592 TGGTATGTTCATGTGGAATAAGG - Intronic
1073796931 10:106998719-106998741 TGGTGTGTGTATGTGGTAGGGGG - Intronic
1074192037 10:111146462-111146484 TTGTATCTGCAAGTGCTGGATGG + Intergenic
1075580930 10:123617868-123617890 TGGTATGTGTGTTTGGTAGAGGG - Intergenic
1076234002 10:128849855-128849877 TTTTAAGTGCAGTTGGTAGAGGG + Intergenic
1080305309 11:30828705-30828727 GTGTGTGTGTATGTGGTGGAGGG - Intergenic
1082822275 11:57552206-57552228 TTGTGTGTGTGTGTGGTGGAGGG - Exonic
1083103901 11:60338336-60338358 TGGTATGTGTGTGTGGTAGGGGG + Intronic
1083416134 11:62526978-62527000 GTGTCTGTGCCTGAGGTAGAAGG - Exonic
1083432165 11:62619274-62619296 TTGTGTGTGCATGTCGCAGGTGG + Intronic
1085249650 11:75134553-75134575 TTGTATGTGCCTTTGATAGAAGG + Intronic
1087466100 11:98508318-98508340 TTCTTTGTGTATGTGGGAGAAGG + Intergenic
1087576883 11:100000338-100000360 TTGTATGTGCATGTGGCCTGTGG - Intronic
1089681700 11:120122255-120122277 GTGCCTGTGCATGTGGGAGAGGG - Intronic
1090030615 11:123203023-123203045 GTGTGTGTGCCTGTGGTAGGTGG - Intergenic
1090997497 11:131880083-131880105 GTGTTTGTGCATGTGGGAGAGGG - Intronic
1091482936 12:853733-853755 ATGTATGTGCTTATGGAAGAAGG + Intronic
1091612144 12:2020064-2020086 TTATGTGTGCATGTGAGAGAGGG - Intronic
1091681100 12:2527574-2527596 GTGTGTGTGCATGTGTTAGTAGG - Intronic
1092027210 12:5251651-5251673 TGGTATGTACATTTAGTAGAGGG + Intergenic
1092151214 12:6250263-6250285 TTGTATTTGCATCTGGTAGGTGG - Intergenic
1093816369 12:23553512-23553534 TGGTGTGTACATGTGGAAGAAGG + Intronic
1095807269 12:46333358-46333380 TTTTAAGTGCAGGTGGGAGAGGG + Intergenic
1096139186 12:49228110-49228132 CTGGATGTGCATGTGTTAAAAGG - Intronic
1097302017 12:58029022-58029044 TTGAAAGTGAATGTGGCAGATGG + Intergenic
1098468541 12:70817781-70817803 TTATATGTGCATGTGCTTGTGGG - Intronic
1099281081 12:80647298-80647320 TTCTATGTCCATGTGGTAGCAGG + Intronic
1101040517 12:100750935-100750957 TGGTGTGTGTGTGTGGTAGATGG + Intronic
1101220561 12:102634857-102634879 GTGTATGTGTATGGGGCAGATGG + Intergenic
1101947462 12:109148818-109148840 TTGTATGTGTGTGTCTTAGAGGG + Intronic
1105765820 13:23558164-23558186 TTGTATGTGTATGTGTTTGAGGG + Intergenic
1105841609 13:24258775-24258797 TTGTTTGTTCTTGTGGTAAAAGG - Intronic
1106642970 13:31605176-31605198 GTGTATGTGTGTGTGGTAGCAGG + Intergenic
1106822524 13:33481619-33481641 TTGTGTGTGAATGTGAGAGAAGG + Intergenic
1109797453 13:67335376-67335398 TAGTATCTGAATGTGGTAGAAGG - Intergenic
1110458839 13:75721404-75721426 TTGTCTGTGCCTCTGGTAGCTGG + Intronic
1111473326 13:88715140-88715162 TTGTATTCTCATGTGGTAGAAGG - Intergenic
1111485564 13:88895154-88895176 TTTTATGTGATTGTGGTAGATGG - Intergenic
1112123700 13:96441073-96441095 TTGAATCTGCATATGGTGGAGGG - Intronic
1112636642 13:101224107-101224129 TTGTTTGTGTATGTGGTGAAGGG - Intronic
1114152616 14:20061727-20061749 ATGTTTGTGCATGTTGGAGAGGG + Intergenic
1114692818 14:24600896-24600918 TGGCATGTGCAAGTGGTTGATGG + Intergenic
1114753933 14:25237241-25237263 TTGCATGTGTATGTGGATGAGGG + Intergenic
1116796524 14:49396765-49396787 TTGTATTTCCATGTGGTTGGTGG - Intergenic
1117595625 14:57324465-57324487 TGCTATGTGGATGTGGTAGTTGG + Intergenic
1117645263 14:57844938-57844960 TTGTATGTGCATGGGGGGGTGGG - Intronic
1118579492 14:67280274-67280296 GTGTATGTGCACGTGCAAGAAGG - Intronic
1118639237 14:67777059-67777081 TTGTCTGTGCTAGTGGAAGAGGG - Intronic
1119057550 14:71438568-71438590 ATTTATGCGCATGTGGTAAAAGG + Intronic
1120433944 14:84456156-84456178 TTGTATGTGTATGTGTTTTAAGG - Intergenic
1121560012 14:94867526-94867548 ATGTATGTGCATGTGCAAGTCGG - Intergenic
1121563272 14:94889923-94889945 ATGTATGTGCATGTGGTGTGTGG + Intergenic
1123055943 14:105570612-105570634 TTGTGTGTGTTTGTGGTATATGG - Intergenic
1123080330 14:105690323-105690345 TTGTGTGTGTTTGTGGTATATGG - Intergenic
1124784813 15:32669748-32669770 TTTTGTGTGTATGTGTTAGAGGG + Intronic
1125198264 15:37073389-37073411 TTGTGTGTGTATGTGGTGGTGGG - Intronic
1125347593 15:38733715-38733737 CTGTGTCTTCATGTGGTAGATGG + Intergenic
1127139562 15:55960876-55960898 TTGACTGTGCATGTCCTAGATGG + Intronic
1128730734 15:70019155-70019177 TGGTTTCTGCATCTGGTAGATGG + Intergenic
1134422887 16:14111194-14111216 TTGGAGGTGCAGGTGGTAGAGGG + Intronic
1137366957 16:47868716-47868738 TTGTATGTGTATGTGTAAGTAGG - Intergenic
1138330150 16:56207002-56207024 TTGTATGTGCCCATGGGAGATGG + Intronic
1141434775 16:83993840-83993862 TTTTATGTGTATGTGTTGGAGGG + Intronic
1143919343 17:10318439-10318461 TTGCATCCTCATGTGGTAGAAGG - Intronic
1144090966 17:11856121-11856143 TTGGATGTGCATGTGGTAGATGG - Intronic
1144955881 17:19018599-19018621 TAGCATGTGCCTGTTGTAGAGGG + Intronic
1148187187 17:45653211-45653233 GTGTATGTGTATGTGTGAGACGG + Intergenic
1148665693 17:49372896-49372918 TTGTATTCACATCTGGTAGATGG + Intronic
1149442043 17:56682494-56682516 TTGTATTTGCATGGCGTAGGTGG - Intergenic
1150839533 17:68595030-68595052 AAATAGGTGCATGTGGTAGATGG - Intronic
1152481420 17:80556191-80556213 TTGTCTGTGGATGGAGTAGAGGG - Intronic
1153835297 18:8958692-8958714 TTGTAGCTGCCTGTGGTATATGG - Intergenic
1153967890 18:10198140-10198162 CTGTGTCTTCATGTGGTAGAAGG + Intergenic
1154492929 18:14934901-14934923 GTGTGTGTGTGTGTGGTAGAGGG - Intergenic
1155320908 18:24618023-24618045 TTGTGTCTTCATGTGGTAGCAGG + Intergenic
1156131668 18:33983417-33983439 TGGTATGTGCATGTGGAAATAGG + Intronic
1159193837 18:65085450-65085472 TTGTATGTGCTTGTGGAATGAGG + Intergenic
1161812804 19:6480130-6480152 TTGTGTGTGCATGTGCCACAAGG + Intronic
1164588200 19:29490806-29490828 TTGTGTGTGCATGTTGAGGATGG - Intergenic
1167771940 19:51526143-51526165 TTGGAAGTGCCAGTGGTAGAGGG - Intronic
925740120 2:6998208-6998230 TTGTATGTGGATGGTGTAGACGG + Intronic
926542523 2:14199204-14199226 TTCTAAGTTCATGTGGTAGTTGG + Intergenic
926947073 2:18200010-18200032 CTGAATGTGCCTGTGGGAGAGGG + Intronic
927245431 2:20953662-20953684 TTGTGTGTGTATGTGGTGTAGGG + Intergenic
927245437 2:20953740-20953762 GTGTATGTGTATGTGGTATGTGG + Intergenic
928811093 2:35227365-35227387 GTGTATGTGCATGTGAGAAATGG - Intergenic
929041377 2:37747932-37747954 TTGAATGTGCAAGTAGTTGATGG - Intergenic
929376977 2:41299298-41299320 GTGTATGTGCAGGAGGTGGAGGG - Intergenic
930902478 2:56524575-56524597 TTGGAGGTCCATGTGGAAGAGGG + Intergenic
931128953 2:59310991-59311013 TTGTATGTCCATGTGTAAGAGGG - Intergenic
931244577 2:60481442-60481464 GTGTATGTGCTTGTGGTGGGTGG - Intronic
931826161 2:66003194-66003216 TTGTGTGTCCATGTGGATGATGG + Intergenic
932067459 2:68580819-68580841 TGGTGTGTGCATGTGGGGGAGGG + Intronic
933430888 2:82177318-82177340 TTGTAGGTGCATGTTACAGAAGG + Intergenic
933620832 2:84539305-84539327 TTGTGTGTGCATGTGTTTGAAGG - Intronic
935116533 2:100142203-100142225 GTGTGTGTGTGTGTGGTAGAGGG - Intronic
935146463 2:100398858-100398880 TTGTGTGTGCATGGGTTGGAGGG + Intronic
938400328 2:130986100-130986122 TTGTGTGTGCATGTAGTGCATGG + Intronic
939040205 2:137179599-137179621 TTGATTTTGCATGGGGTAGAAGG - Intronic
939290241 2:140184371-140184393 GTGTATGTGCATGTGTTTGTGGG + Intergenic
940865766 2:158816554-158816576 GTGTGTGTGTGTGTGGTAGAGGG - Intronic
941548539 2:166885178-166885200 TTGTTTGTTCATGTGGAAGAAGG + Intergenic
942363668 2:175199138-175199160 TTATTTTTGCATGTGGTATAAGG - Intergenic
944360865 2:198854816-198854838 TTGTATGTGTTTGGGGCAGAGGG - Intergenic
944597326 2:201273015-201273037 TAAGATGTGCATGTGGTAGAAGG - Intronic
945313324 2:208341653-208341675 TTGTATTCTCATGTGGTGGAAGG + Intronic
945752846 2:213809891-213809913 TTCTAGTTGTATGTGGTAGAAGG + Intronic
945897894 2:215505083-215505105 TTGTCTGTGGATGAGATAGAAGG - Intergenic
947026507 2:225743623-225743645 TCCTGTGTTCATGTGGTAGATGG + Intergenic
947108712 2:226695723-226695745 GTGTGTGTGTGTGTGGTAGAGGG - Intergenic
949082600 2:242116422-242116444 TTGCATGTGCATGTGGTATGTGG + Intergenic
949085698 2:242152724-242152746 GTGTGTGTGCATGTGGTAGTGGG - Intergenic
1169029899 20:2398836-2398858 TAATACCTGCATGTGGTAGAGGG - Intronic
1170104563 20:12739405-12739427 CTTTATGTGAATGTGGAAGAAGG + Intergenic
1170952964 20:20953313-20953335 TAGAATGTGCAACTGGTAGAAGG - Intergenic
1172490423 20:35332225-35332247 TTGTATGTGCATGTACTAACTGG + Intronic
1172721644 20:37003352-37003374 GTGAAAGTGCATTTGGTAGATGG - Intronic
1173610042 20:44360459-44360481 ATGTAGGTGCATGTGATAAATGG + Intronic
1175612622 20:60364359-60364381 TTGTGTGTACATGTGATAGATGG + Intergenic
1175631549 20:60542328-60542350 TTTTATGTTCATTTGTTAGATGG + Intergenic
1177124511 21:17179678-17179700 TTGTATTTGCATGTTTTTGAGGG - Intergenic
1177481853 21:21700420-21700442 TTGTATCACCTTGTGGTAGATGG + Intergenic
1179391191 21:40993344-40993366 TGGTGTGTGTATGTGGTAGGTGG - Intergenic
1181676006 22:24453004-24453026 TTGTATGGGAATGTGGTATGTGG + Intergenic
1183498057 22:38161690-38161712 AGGTGTGTGCATGGGGTAGAGGG + Intronic
1185013867 22:48332243-48332265 TGGTATGTGCATGTGGTGTCTGG - Intergenic
949276271 3:2286239-2286261 TTGTATGTGTATGTTGTGGGGGG - Intronic
950893345 3:16425243-16425265 TTGTATGTACATGTGGGAAGAGG + Intronic
951452796 3:22858372-22858394 TTTGATGTGCAGGTTGTAGATGG - Intergenic
952106607 3:30077437-30077459 TTGTGTGTGCATGTGCCAGCAGG - Intergenic
952698612 3:36300157-36300179 ATGTACCTGCATGTGGTACATGG + Intergenic
953199493 3:40766274-40766296 GTGGATGGGCATGGGGTAGAAGG + Intergenic
956408018 3:68949004-68949026 TTGTGTGTGTATGTGTGAGATGG + Intergenic
957479477 3:80772795-80772817 TTGTATGTGCATTAGGCAAAGGG + Intergenic
957654494 3:83057513-83057535 TTGTAAGTGCATTTTGAAGAAGG + Intergenic
957699305 3:83688186-83688208 AAGTCTGTGCATGTGGGAGAGGG - Intergenic
959496870 3:107061771-107061793 TTGTATGTGCACATGATGGAAGG - Intergenic
961932500 3:130548440-130548462 TTAGATTTGCATGTGGGAGAAGG - Intergenic
961933484 3:130558323-130558345 TTGTGTGTGCATGGGGTGGGTGG - Intergenic
962038980 3:131684854-131684876 TTGAATGTGTGTGTGGTAGTGGG + Intronic
962687912 3:137865287-137865309 TTGTAACTTCATGTGGCAGAGGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965507520 3:169532754-169532776 TTGTGTGTGCATGTGGGGTAGGG - Intronic
966828032 3:183981689-183981711 TTGTATGTGCATGTGGTAGAAGG - Intronic
967995139 3:195160773-195160795 GGGTCTGAGCATGTGGTAGAGGG + Intronic
968799949 4:2736129-2736151 CTGTATCTTCATATGGTAGAAGG + Intergenic
970458364 4:16247820-16247842 GTGTATGTGCATGTGGTATCTGG + Intergenic
970677238 4:18464996-18465018 ATGTCTGTGCATGTGGTGTAAGG - Intergenic
970697649 4:18696743-18696765 TGGAATTTGCATGTGGTGGAAGG + Intergenic
972152594 4:36112598-36112620 TTGTATGACCCTGTGGTACAAGG - Intronic
974116089 4:57580688-57580710 TTGTATATGGATGGTGTAGAGGG + Intergenic
974225706 4:59040162-59040184 TTGTATCTGTATTTTGTAGATGG + Intergenic
975510011 4:75183748-75183770 ATGTATGTGCATGCTGTTGAGGG - Intergenic
975816018 4:78217758-78217780 TTGTAGGTTCATGAGTTAGAGGG - Intronic
978435434 4:108679058-108679080 GTGTGTGTGTGTGTGGTAGAGGG - Intergenic
978499555 4:109394209-109394231 ATGTAGGTGCTTGAGGTAGAAGG + Intergenic
978566226 4:110085157-110085179 ATGTATGTGCATGCGTTGGAGGG + Intronic
979263138 4:118671003-118671025 GTGTGTGTGCATGTGGTGGTGGG - Intergenic
979267950 4:118725391-118725413 TTGTAGTGGCATGTGGGAGAGGG - Intronic
979795674 4:124843782-124843804 GTGTATGTGGTGGTGGTAGAAGG + Intergenic
979848174 4:125543459-125543481 GTGTGTGTGCGTGTGGTAGTAGG - Intergenic
980341451 4:131553531-131553553 TTGTATGTTTATATAGTAGAAGG - Intergenic
980858200 4:138465840-138465862 TTGTGTGTGCATTTGTTAGGGGG + Intergenic
980919482 4:139068548-139068570 ATGTATCTGCATGTGGAAGTGGG - Intronic
982069324 4:151681824-151681846 CTGTGTCTGCATGTGGTGGAAGG + Intronic
982103674 4:151992954-151992976 TTGAATGTGCTTGTGGTATTGGG + Intergenic
982121772 4:152150128-152150150 TTGTCTCTTCATGTGGTGGAGGG + Intergenic
983077798 4:163346060-163346082 GTGTATGTTTATGTGGTAGATGG + Intronic
983231616 4:165134788-165134810 ATGTGTGTGCATGGGGTAGTAGG + Intronic
984231358 4:177103928-177103950 TTTTCTGTGTATGTGATAGATGG - Intergenic
984561459 4:181275963-181275985 TTGTATATTCATGTGGCAAAAGG + Intergenic
985379710 4:189379857-189379879 TTGCAGGTGCATGTGCTAGCTGG - Intergenic
986822427 5:11482317-11482339 TTGTATGTGTAGGTGGTGGAGGG - Intronic
987880574 5:23739634-23739656 GTGTGTGTGCATGTGTTAGTTGG + Intergenic
988035943 5:25827670-25827692 AGGTATGTGCATATGGTATATGG - Intergenic
988554534 5:32224742-32224764 TTGTATGTGTGTGTGGAAGGTGG + Intergenic
989714536 5:44445981-44446003 TTGTATGTGCTTGGAGTAGTTGG + Intergenic
990385260 5:55254180-55254202 TTGAATGTGCATGTAGTTGTGGG + Intergenic
990690477 5:58358462-58358484 TTGTATTTGGATGTGCTAGTTGG - Intergenic
990896709 5:60707483-60707505 TTGCATGTGCGTGTGGTCCATGG - Intergenic
990962718 5:61411727-61411749 CTGTGTCTTCATGTGGTAGAAGG + Intronic
991376303 5:65971691-65971713 TTCTATGTCCATATGGTAGAAGG + Intronic
995663453 5:114512579-114512601 TTGGAGGTGCAGGTGGGAGAAGG + Intergenic
995748506 5:115429148-115429170 TTGTCTTTCCATGTGGCAGAAGG + Intergenic
995806828 5:116062384-116062406 TAGTCTGTGGATGTCGTAGATGG + Intergenic
998047560 5:139001551-139001573 CTGTGTGTGTATGTGGTAGGGGG + Intronic
998883264 5:146667012-146667034 ATGTGTGTGAATGTGGGAGATGG + Intronic
1000918987 5:167116417-167116439 TTCTGTGTGAATGTGGTAGTGGG + Intergenic
1001403821 5:171461995-171462017 TAGGATGTGCATTTTGTAGATGG + Intergenic
1002737835 5:181409592-181409614 GTGTGTGTGCATGTGGTAGTGGG - Intergenic
1003523671 6:6880897-6880919 TAGAATGTGGATGTGGTAGCTGG - Intergenic
1003527768 6:6912135-6912157 TCGTTTCTTCATGTGGTAGAAGG - Intergenic
1003738521 6:8906591-8906613 TTGTATTTTCATGTTGTAAATGG + Intergenic
1003921366 6:10836401-10836423 TTGTATGTTCAGGGGATAGAAGG - Intronic
1004318920 6:14616996-14617018 TTCTATGTGCATGTGCATGAAGG + Intergenic
1004771955 6:18794060-18794082 TTGTATGTGTATGTGTGAGTAGG + Intergenic
1005565018 6:27082814-27082836 TTGAATGTGGAAGAGGTAGAGGG + Intergenic
1005629909 6:27697538-27697560 ATGTATGTGCTTATGGTAGAGGG + Intergenic
1005784261 6:29226954-29226976 GTGGATGTGCATGTGGAAGAAGG - Intergenic
1008685692 6:53924147-53924169 TTGTATGTTCAAGTGATAGCAGG + Intergenic
1009816316 6:68740508-68740530 TTGGATGAGAATATGGTAGAAGG + Intronic
1011304903 6:85915170-85915192 GTGTATGTGTATGTGGTGAAGGG + Intergenic
1011870838 6:91890168-91890190 ATGTATGAGCATATGGTATATGG + Intergenic
1012604096 6:101135280-101135302 TTTTTTATGAATGTGGTAGACGG - Intergenic
1012986018 6:105877246-105877268 TTGTATCCTCACGTGGTAGAAGG + Intergenic
1013374984 6:109505966-109505988 CTGTATTCTCATGTGGTAGAAGG + Intronic
1013585443 6:111574678-111574700 TTGGATGTCCATGTGGTATTGGG - Intronic
1013627492 6:111952235-111952257 GTGTATGTGGAGCTGGTAGAGGG - Intergenic
1014072665 6:117201401-117201423 TTTTCTGGGTATGTGGTAGAGGG - Intergenic
1014513071 6:122348796-122348818 TTCTATTTGTAGGTGGTAGAAGG + Intergenic
1014893378 6:126870090-126870112 TTGTATCTGCATGTTGTATTTGG - Intergenic
1017232266 6:152085724-152085746 TTCTAAGTGCATGTCGTAGAAGG - Intronic
1017804469 6:157931838-157931860 GTGTCTCTGCATCTGGTAGAGGG + Intronic
1019242934 6:170685150-170685172 GTGTGTGTGCATGTGGTAGTGGG - Intergenic
1021584746 7:22195915-22195937 TTCTATGTGCATGTGATATATGG + Intronic
1023531400 7:41159117-41159139 TAGTTTGTGTATGTGGAAGAAGG - Intergenic
1023871362 7:44264641-44264663 TTGGGTGTGCAGGTGGGAGAGGG - Intronic
1024138200 7:46432072-46432094 CAGCATGTGCATGTGGCAGAGGG - Intergenic
1028828177 7:95298447-95298469 TACTATGTGCATGGAGTAGAGGG + Exonic
1029345588 7:99976255-99976277 TTGTGTGTGCCTGGGGTGGAAGG + Intergenic
1029440354 7:100583822-100583844 GTGTGTGTGCATGTGGACGAAGG + Intronic
1029695872 7:102212848-102212870 TTGTGTGTACATGTGTGAGAGGG + Intronic
1030283916 7:107805589-107805611 TTGTATTTAGATGTGGTTGATGG + Intergenic
1030998208 7:116384333-116384355 TGGTATATGCATATGGTATATGG - Intronic
1034680592 7:152925104-152925126 TGGTTTGTGGATGTGGAAGAGGG + Intergenic
1035505187 8:123012-123034 GTGTGTGTGCATGTGGTAGTGGG + Intergenic
1035540526 8:433125-433147 TTGCATGTGCATGTGGTATGTGG + Intronic
1035626312 8:1073664-1073686 CTGTGTGTGCATTTTGTAGATGG + Intergenic
1036012206 8:4738913-4738935 GTGTGTGTGTATGTGTTAGAAGG + Intronic
1036161497 8:6393046-6393068 ATGTATCTTCATGTGGTGGAAGG - Intergenic
1039027865 8:33277626-33277648 TGTTATGTGGATGTGGTGGAGGG + Intergenic
1041159882 8:55028982-55029004 TTGTATGTGAGTGTGGTTCAGGG - Intergenic
1041953248 8:63528275-63528297 ACGTATGTGCATGGGGGAGAGGG + Intergenic
1042652205 8:71055440-71055462 TTGTATGTGGTTTTGGAAGATGG + Intergenic
1043852725 8:85233140-85233162 TGGTTTGTGCATCTGGTGGATGG + Intronic
1044094727 8:88048997-88049019 TTCTATGTGCACGTTGAAGATGG - Intronic
1044518803 8:93173836-93173858 GTGTGTGTGCATGTGCTATAAGG + Intergenic
1047677996 8:127223936-127223958 TTGTATGTGCATGTGCACGAAGG - Intergenic
1050209574 9:3238413-3238435 TTGTGTGTGCATGTGTTTGCTGG + Intronic
1051484133 9:17589915-17589937 TTCTAGGTACATCTGGTAGACGG + Intronic
1052668243 9:31521587-31521609 CTGTATCCTCATGTGGTAGAAGG + Intergenic
1056934789 9:90908109-90908131 TAGTGTGTGCATGTGGTATGTGG + Intergenic
1060082024 9:120657662-120657684 TTGTATGAGCATGTTTTAGGGGG + Intronic
1060414138 9:123418890-123418912 ATGTTTGTGCATGGGGCAGAGGG + Intronic
1060475436 9:123983205-123983227 GTGTGTGTGAGTGTGGTAGAGGG - Intergenic
1203603125 Un_KI270748v1:34374-34396 GTGTGTGTGCATGTGGTAGTGGG - Intergenic
1186103152 X:6177940-6177962 CTGTATCCTCATGTGGTAGAAGG - Intronic
1186815129 X:13229174-13229196 TTATATGTTCATGTGATACAAGG - Intergenic
1187992307 X:24888218-24888240 TAGTATATGCATATGGTAGTAGG - Intronic
1188596011 X:31900967-31900989 TTGTATGTGCATATGGGGAAAGG + Intronic
1189185217 X:39049001-39049023 GTGTGTGTGTGTGTGGTAGAAGG - Intergenic
1190072079 X:47287871-47287893 TTGTTTGAGCATGTGGTGAAGGG + Intergenic
1190554702 X:51622136-51622158 TTGTGTGTGAATATTGTAGATGG + Intergenic
1191193899 X:57700125-57700147 AAGTATGTGTATGTGGTGGAAGG - Intergenic
1192929198 X:75786932-75786954 ATGAATGTGCATGTTCTAGACGG + Intergenic
1194492443 X:94568491-94568513 ATGTATGTGCTTGTGGGAGGGGG - Intergenic
1195464276 X:105162868-105162890 TTGTGTCCTCATGTGGTAGAAGG + Intronic
1197846403 X:130808465-130808487 GTGTATGTGAATGGGTTAGAAGG + Intronic
1198033260 X:132776102-132776124 TTGTATGATCATGGGGTGGATGG + Intronic
1198500368 X:137238717-137238739 GTGTATGTGAATGGGGGAGAAGG - Intergenic
1199716440 X:150510384-150510406 GTGAATGTGCGTGTGGGAGAAGG - Intronic
1201427547 Y:13869916-13869938 GTGTGTGTGCATGTGGTGGGAGG - Intergenic
1201492271 Y:14555368-14555390 TTGTATCCTCATGTGGTGGAAGG + Intronic
1202385200 Y:24319428-24319450 GTGTGTGTGCATGTGGTGGTGGG - Intergenic
1202485585 Y:25350700-25350722 GTGTGTGTGCATGTGGTGGTGGG + Intergenic