ID: 966829562

View in Genome Browser
Species Human (GRCh38)
Location 3:183995251-183995273
Sequence CTGCATGAATGGCCCTAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966829562 Original CRISPR CTGCATGAATGGCCCTAATT AGG (reversed) Intronic
902731072 1:18369139-18369161 CAAGATGAAGGGCCCTAATTGGG + Intronic
905092576 1:35441208-35441230 GTGCATGCAGGGCCCTATTTTGG + Intronic
907632829 1:56101034-56101056 CTGCCTGAACAGCCCTTATTTGG - Intergenic
908423612 1:63983522-63983544 CTTCAAGAATAGCCCTAAGTGGG - Intronic
908644197 1:66259577-66259599 CTGGCTGAGTGGCCCTCATTTGG + Intronic
910737382 1:90475219-90475241 CTGCATGAATTGCAAGAATTTGG - Intergenic
911363680 1:96910823-96910845 CTGCTTCATTGGCTCTAATTGGG + Intergenic
917180619 1:172293061-172293083 CTGCATTAAATGCCTTAATTAGG + Intronic
917376874 1:174358275-174358297 TTGCATAAATGGACCTGATTGGG - Intronic
921116068 1:212092919-212092941 CTGCAAGAATGGCCATCATTGGG - Intronic
921539160 1:216391983-216392005 CTGAATGAATGGCCTTAAGAAGG - Intronic
921898784 1:220428589-220428611 CTCCATGAAGGGCCTTAATAAGG + Intergenic
922514020 1:226193273-226193295 CTGGAAGCCTGGCCCTAATTTGG - Intergenic
1066110082 10:32187936-32187958 CTGCAGGAATGGCCATGTTTGGG + Intergenic
1066496171 10:35944506-35944528 CTGCATGCATGTCCCTAAAAAGG - Intergenic
1071033438 10:81213173-81213195 CTGTATGACTAGCCCCAATTGGG + Intergenic
1071171092 10:82864952-82864974 CTGCATGCCAGGCCCTAATCAGG - Intronic
1072324398 10:94282974-94282996 CAGCCTGCATGGCCCTGATTTGG + Intronic
1073583689 10:104689089-104689111 CTGCATGACTTGCCCTCTTTAGG + Intronic
1074881867 10:117665921-117665943 ATGCAAGAATGCCCCTAATACGG - Intergenic
1077390161 11:2297107-2297129 CTGCAGGGATGGCCCTGAGTAGG + Intronic
1079131384 11:17748831-17748853 CTGCATGGAGGGCCGTAATGAGG + Intronic
1080075920 11:28149440-28149462 CTGCAAGAATGGCCCTGGTGTGG - Intronic
1084341626 11:68507450-68507472 CTGCATAAATGCCCATAATCAGG - Intronic
1087860909 11:103154532-103154554 CTTCATAAAAGGCCCAAATTTGG - Exonic
1091815761 12:3436635-3436657 CTGGGTGCATGGCCATAATTGGG + Intronic
1092798456 12:12138352-12138374 CTGCATGAATGTCACTAAGCTGG + Exonic
1092859152 12:12704787-12704809 CTTCATGAATGTTCCGAATTGGG + Intergenic
1095252679 12:39997528-39997550 CTGCAAGAATTGCCATAATCAGG + Intronic
1098362890 12:69672397-69672419 CTGCATGAAATGCACTAAATGGG - Intronic
1099764678 12:86968553-86968575 CTGGAAAAATGGCCCGAATTTGG + Intergenic
1105040859 12:132959896-132959918 ATGGATGAATGTCCATAATTTGG - Intergenic
1106475098 13:30091652-30091674 TTGCATAAATGGGCCTGATTAGG + Intergenic
1107456446 13:40559984-40560006 CGTCATGATGGGCCCTAATTCGG - Exonic
1108217093 13:48196030-48196052 CAGCATGAATGACCATATTTTGG + Intergenic
1110476595 13:75922215-75922237 CTGCTTGAATGGTACTAAATTGG - Intergenic
1112658952 13:101485502-101485524 CTATAAGAATGGCCGTAATTAGG + Intronic
1115898630 14:38119209-38119231 TTGCATAAATGGACCTGATTGGG + Intergenic
1121667176 14:95681398-95681420 TTGCATAAATGGACCTGATTGGG + Intergenic
1133998301 16:10763627-10763649 CTGCATGAATGGATGTGATTGGG + Intronic
1135139984 16:19912957-19912979 ATGGATGAATGGGCCTCATTTGG + Intergenic
1139096915 16:63715477-63715499 CTTCAAGAAGGGTCCTAATTTGG - Intergenic
1146697861 17:34924964-34924986 CTGCATTAATGTTCCTATTTTGG + Intergenic
1151149801 17:72075287-72075309 CCGCATGTGTGGTCCTAATTAGG + Intergenic
1156324964 18:36066969-36066991 CTGAATTTCTGGCCCTAATTGGG + Intronic
1156510229 18:37630233-37630255 CTGCATCATTGGCCATAATGGGG + Intergenic
1159567671 18:70071742-70071764 CAGCATGAAAGTCCCTAACTTGG + Intronic
1160507729 18:79436800-79436822 CTGAAGGAAAGGCCCTAAATGGG - Intronic
925464873 2:4098203-4098225 TTGCATGAAAGTACCTAATTTGG - Intergenic
927092851 2:19725648-19725670 TTGCATAAATGGACCTGATTGGG + Intergenic
927810103 2:26175809-26175831 CTGCAAGAAGGGCCCTACTGGGG - Intronic
930160508 2:48151221-48151243 CTGAAAGAATGGCCCTTTTTTGG - Intergenic
931371241 2:61665021-61665043 CAGCATGTATGGACCTTATTTGG + Intergenic
934812679 2:97296268-97296290 CTTCATGCATGTCCCTAAATAGG - Intergenic
934825015 2:97412204-97412226 CTTCATGCATGTCCCTAAATAGG + Intergenic
935192292 2:100788130-100788152 TTGCATAAATGGACCTGATTGGG + Intergenic
935489364 2:103698119-103698141 CTGGAGGAATCCCCCTAATTGGG + Intergenic
939520705 2:143226302-143226324 CTGGATAAATGGCTCTGATTTGG - Intronic
943437995 2:187891363-187891385 CTGCATGAGTTGTCCTACTTGGG - Intergenic
943662313 2:190572031-190572053 CTTTTTGAATGGCCCCAATTTGG - Intergenic
944802751 2:203252850-203252872 GTGAATGGAGGGCCCTAATTAGG - Intronic
946126589 2:217568151-217568173 CTGGATGTATGGCCCTGAGTAGG + Intronic
947905558 2:233759200-233759222 TTGCATAAATGGACCTGATTGGG - Intronic
948151487 2:235747994-235748016 CTGCACGAATGTTCATAATTGGG + Intronic
1168985372 20:2043788-2043810 CTGCATGGATGGTCCTCATTGGG + Intergenic
1169035155 20:2444651-2444673 TTGCATAAATGGACCTAATTGGG - Intergenic
1173968519 20:47132345-47132367 TTCCAAGAATGGCCCTAGTTTGG + Intronic
1179341599 21:40515999-40516021 CTGCATGTGTGCCACTAATTTGG + Intronic
1179580225 21:42338748-42338770 CTGCATGCATGGCCCTGAAATGG + Intergenic
1180788534 22:18560417-18560439 CTACATGAAAGGCACTAAATGGG + Intergenic
1181233203 22:21434901-21434923 CTACATGAAAGGCACTAAATGGG - Intronic
1181245447 22:21499942-21499964 CTACATGAAAGGCACTAAATGGG + Intergenic
949096668 3:94668-94690 CAGAATGTATGGGCCTAATTTGG + Intergenic
954096110 3:48330041-48330063 CTAAATGAATGGCCTTAACTGGG + Intergenic
955666741 3:61356967-61356989 CTGCATCAATGATGCTAATTTGG + Intergenic
958551809 3:95623289-95623311 CTGCCTGAATGGCTCATATTAGG + Intergenic
959355010 3:105315264-105315286 CTGTATGAATGGGCCAAACTTGG - Intergenic
961176997 3:124843804-124843826 CTGTATGCATGGCGCTTATTTGG - Intronic
963384143 3:144568998-144569020 CTGCAAAAATGGCCATAATTAGG + Intergenic
963676462 3:148317412-148317434 CTGCATAAATGAACCTGATTGGG - Intergenic
964478539 3:157119699-157119721 TTGCATAAATGGACCTGATTGGG + Intergenic
966514658 3:180805332-180805354 CTGCCTGAATGGCCCAGAATAGG + Intronic
966829562 3:183995251-183995273 CTGCATGAATGGCCCTAATTAGG - Intronic
980164433 4:129208248-129208270 CTGAATGAATGACACTTATTGGG + Intergenic
982215623 4:153080456-153080478 CTCCAGGAATGGGTCTAATTGGG - Intergenic
983347391 4:166544537-166544559 CTGCAATAATGGCCGTAATTAGG + Intergenic
985325999 4:188770860-188770882 CTGCAAGAATGGCCATGATTTGG - Intergenic
993333496 5:86628461-86628483 CTGCATGAATGGTATTTATTAGG - Intergenic
993919671 5:93785259-93785281 CTACACTAGTGGCCCTAATTTGG + Intronic
1006046478 6:31303181-31303203 ATGCAAGAATGGCATTAATTTGG - Intronic
1006195603 6:32239946-32239968 CTGGAGGAATGGCCCTGAGTAGG + Intergenic
1013979096 6:116108868-116108890 CTGCATGACAGGGCCAAATTTGG - Intronic
1014229948 6:118892326-118892348 CTACCTGAATGCCACTAATTTGG - Intronic
1018748549 6:166781554-166781576 CTGCATGCATGCACCTAAGTTGG + Intronic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1022633477 7:32108703-32108725 CTGCATGAATGTTCATGATTTGG + Intronic
1023098673 7:36690306-36690328 CTGCAGGAAAGGCCATAATGGGG + Intronic
1023163042 7:37316471-37316493 CTGCATGATTGGCATTTATTGGG - Intronic
1026533405 7:71220138-71220160 TTGCATAAATGGACTTAATTGGG - Intronic
1032415526 7:131732676-131732698 CTGCATGAAGGCACCTATTTGGG + Intergenic
1035885297 8:3285044-3285066 TTGCTTCAATGGCCCTAAATAGG - Intronic
1036552702 8:9829012-9829034 TTAAATGAATGGCCCCAATTGGG - Intergenic
1039092908 8:33851653-33851675 TTGCATAAATGGACCTGATTAGG + Intergenic
1040809096 8:51430534-51430556 TTGCATAAATGGACCTGATTGGG + Intronic
1041333331 8:56751929-56751951 GTGAATGAATGACCCTAAGTGGG - Intergenic
1046080716 8:109367210-109367232 CTACATGAATGAACTTAATTTGG + Intronic
1047108528 8:121762155-121762177 CTTCATGTATGGCCATAAATAGG - Intergenic
1047524080 8:125617650-125617672 CTGAATGAATGGCACTGACTTGG + Intergenic
1049553842 8:143272684-143272706 CTGCAGAAATGGCCCGAATGTGG + Intronic
1049714654 8:144084159-144084181 CTGCCTGAATGGCCCCAGCTCGG - Exonic
1050009193 9:1169027-1169049 CTGAATGAATTGCCCTAACTAGG + Intergenic
1060029564 9:120202695-120202717 TTGCATGAATGGACCTGATTGGG + Intergenic
1190567755 X:51748185-51748207 CTCTGTGAATGGCCCCAATTTGG - Intergenic
1191097725 X:56691563-56691585 CTGCAAGAATGTTCATAATTAGG + Intergenic
1194430817 X:93802123-93802145 TTGCATAAATGGACCTTATTGGG - Intergenic
1196394116 X:115241177-115241199 TTGCATAAATGGACCTCATTGGG + Intergenic
1199898442 X:152149285-152149307 CTGCAGCAATGGCCCTAATTTGG - Intergenic
1200786073 Y:7261548-7261570 CTGCATGGATAGACCTAATTTGG + Intergenic